1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dedylja [7]
2 years ago
9

A____ is the smallest particle of an element that has the chemical properties of that element

Biology
1 answer:
Reptile [31]2 years ago
5 0

Answer:

the answer is an atom :)

You might be interested in
How is heat gained in the body
dlinn [17]

Answer:

through radiation ,conduction,convection e.t.c

Explanation:

hope it helps

7 0
2 years ago
Read 2 more answers
What is the function of the human rectum?? ​
inysia [295]

Answer:

The function of rectum is to store the feces temporary before it is excreted out from the human body.

Explanation:

The end part of large intestine is called rectum and it is connected to the anus. The distal part of rectum is called ampulla and feces is stored here temporarily.  When stored feces increases its walls expand. There are receptors present in its wall that send a signal to the brain and feces is discharged out of the body.

7 0
3 years ago
What is the expanded portion of a longitudinal wave
morpeh [17]

Answer:

well longitudinal waves are waves that move the medium parallel to the direction in which the waves travel

Explanation:

in waves, there is compression and rarefaction which is what makes up the distance of the wave. i hope this helps. if it doesn't, lmk and i'll fix it

7 0
2 years ago
to -10.0 °C, wait until all the water has frozen, and then wait a little while more. What happens to the ice temperature after a
adelina 88 [10]

Answer:

Explanation:

I believe it will just get colder tbh

4 0
2 years ago
What is the name of the geometric figure which has the minimum eccentricity
creativ13 [48]
It is simply a circle.
4 0
3 years ago
Other questions:
  • What is the key term for the mass of bacteria that forms when bacteria are grown on agar?
    15·1 answer
  • 15. Which is not a problem associated with the increased use of nuclear energy?
    10·1 answer
  • Which protist is the most widely known form of marine plankton and is thought to have given rise to plants?
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Mutated codons code for what in silent mutations?
    13·1 answer
  • In a solution, solute substances naturally tend to move from areas of higher concentration to areas of lower
    6·2 answers
  • HELP PLS I WILL GIVE U BRAINLY
    13·1 answer
  • Observations are things that can be perceived with senses (i.e., sight, sound, smell, taste, and touch).
    10·1 answer
  • 2. Which of the following cloud types would most likely produce precipitation?
    9·1 answer
  • 1. Which sentence about galaxies provides evidence of universe expansion that supports the Big Bang Theory?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!