1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
77julia77 [94]
2 years ago
8

Gregor Mendel's research consisted of using parent pea plants that were pure breeds. What genotype(s) would be considered pure b

reeds? (use the letter "B" and/or "b" in your genotype) *
Biology
1 answer:
laila [671]2 years ago
8 0

Answer:

The genotypes thatwould be considered pure breeds are BB and bb

Explanation:

The genotype of an organism refers to an organism's complete set of genetic material or genes.

Genes are units of DNA that carries information for a particular physical or functional trait or character in an organism. Some genes act as instructions to make proteins while some genes do not code for proteins. The proteins made by a gene expresses the traits and characters of that organisms. Genes for a particular trait may have one or more variants known as alleles.

In Gregor Mendel's research using pea plants, flower colour in a pea plant had two different alleles; one for red flower colour and one for white flower colour. If a plant had the same allele for flower colour, the plant was considered a pure breed.

For example, given B was the allele for red flower colour and b was the allele for white flower colour, a plant having the two alleles for white flower colour bb, is a pure breed. Similarly, a plant having the two alleles for red flower colour, BB is a true breed.

You might be interested in
Microtubles functions include
nalin [4]

Explanation:

  • It gaves shape to the cellular membrane

  • Transportation of specific organelles within the cell.

3 0
3 years ago
Read 2 more answers
I don’t understand I don’t under math smh bio
stellarik [79]
What? I don’t know what ur saying no offense
7 0
1 year ago
Which term best describes a spinal cord
atroni [7]

Answer:

Explanation:

I think peripheral nervous system!!

5 0
2 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
1. Which of the following distinguishes anaerobic respiration from aerobic
gogolik [260]

Answer:

option b is correct

Explanation:

aerobic respiration produce 38 ATP per glucose molecule while anaerobic respiration produce only 2 ATP per glucose molecule

6 0
2 years ago
Other questions:
  • -Listening to Earth - How is this related to plate boundaries?
    13·1 answer
  • Why must all living things excrete waste products
    15·2 answers
  • Which of the following is needed for cellular respiration to occur? (4 points)
    8·1 answer
  • Which list below describes the next steps of evaporated water through the water cycle?
    14·1 answer
  • Given the sequence of the dna "AAC TGC CCT" create the complementary mRNA strand. (Use base pairing rules for DNA to RNA)
    14·1 answer
  • What must happen before meoisis can begin
    9·2 answers
  • Industrialization is one of the cause of environmental degradation.Explain.
    11·1 answer
  • How are coral reefs similar to tropical rainforests? Both are home to just a few types of rare animals. Both can easily be resto
    6·2 answers
  • Photosynthesis and cellular
    13·1 answer
  • A group of scientists discovered a new organism that is composed of many cells, gets its nutrition from decaying organisms, and
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!