1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
poizon [28]
3 years ago
5

Ecological niche in a sentence

Biology
1 answer:
Bogdan [553]3 years ago
6 0
The ecological niche of an ant is to gather food for its army of ants.
You might be interested in
The crossover frequency between genes D and G is 32% how many units apart are genes D and G on the chromosome?
Katen [24]

Answer:

32 map units

Explanation:

hope it helps

8 0
2 years ago
What does the process of gene duplication and divergence refer to? (select all that apply)?
Debora [2.8K]

It refers to making or crating new genes in form of mutation in duplicates of old genes. It is also a mechanism in major way through new genetic material is generated during evolution. The duplication happens in event termed unequal crossing over or recombination between misaligned homologous chromosomes during meiosis. 

7 0
4 years ago
Help me with this pleaseeeeeeeeeee
KatRina [158]
A: Energy hope this helps
6 0
3 years ago
What is the net gain in ATP in glycolysis?
Butoxors [25]

Glycolysis, the first process in cell respiration, produces four ATP, but it uses two of the ATP molecules, therefore producing a net two ATP molecules. The process also yields two molecules of NADH.Glycolysis begins with glucose and breaks it down into two molecules of phosphoglyceraldehyde.


Hope this helps


7 0
4 years ago
Read 2 more answers
Name the enzyme produced by each organ please help me
Alja [10]

Answer:

Boca  ptialina  actúa sobre los almidones

Estomago pepsina almidones y azucares

Hígado fosfatasa alcalina, alanina aminotransferasa y aspartato aminotransferasa. Transforman el alimento en energía

Explanation:

7 0
3 years ago
Other questions:
  • ion-linked gated channels are receptor proteins through which ions pass. A cell biologist has blocked these channels in a lab ra
    8·1 answer
  • .Sea and land breezes over a large region that change direction with the season are called _____.
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The gene form of a trait is called a(n)
    11·1 answer
  • What is an advantage of recycling metals?
    11·2 answers
  • The process in which a solid changes to a liquid is called
    9·2 answers
  • 1. is the force that pulls objects towards Earth.
    14·1 answer
  • If individuals II-2 and II-3 make offspring, what percent probabilities in which the children would be:
    12·1 answer
  • How do electric charges behave?
    10·1 answer
  • If pathogen A is more resistant to an erythromycin disc on a Kirby-Bauer plate compared to pathogen B, then pathogen A will have
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!