1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nika2105 [10]
2 years ago
5

According to the data, which medium would allow sound waves to travel the fastest?

Geography
2 answers:
Brrunno [24]2 years ago
7 0
The answer is D. air
Vesna [10]2 years ago
3 0
I think it would be D..
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Why do hot stars look bluer than cool stars?
Bezzdna [24]
As stars get older they get cooler and you know when you light a flame the part at the bottom is hotter so its also applies to stars, the star is very hot because it is newer and has more gas so it appears blue to us
7 0
3 years ago
The __________ Mountains are Africa's longest mountain chain and are located in the northwestern part of the continent.
klemol [59]
~Hello there!

Your question: The __________ Mountains are Africa's longest mountain chain and are located in the northwestern part of the continent.

Your answer: The Atlas Mountains are Africa's longest mountain chain and are located in the northwestern part of the continent.

Any queries ^?

Hope this helps!
4 0
3 years ago
Read 2 more answers
Why is it important for animals to consume protein?
Anna35 [415]

Answer:

C

Explanation:

Food molecules (carbohydrates, protein, and lipids) are digested into sugar molecules, fatty acids, and amino acids by the action of enzymes. These nutrients are consumed in catabolic reactions to produce the energy required by the cells. ... They generate energy only in the absence of glucose or fat in the body.

6 0
2 years ago
Which section of ocean floor is near the coastlines of all continents?
Reptile [31]
The correct answer is the , Shallow ocean
7 0
3 years ago
Other questions:
  • The image shows a volcano erupting at night in Russia.
    11·2 answers
  • Early scientists believed that the Sun and planets all orbited Earth. Eventually scientists were able to use telescopes and
    15·1 answer
  • Describe two ways in which a corn plant is apart of each following abiotic cycles
    6·1 answer
  • Countries where mahogany, palisander, sapele and chlorophlora can be sourced. Packing options for transporting the wood and thei
    14·1 answer
  • The spread of Buddhism from India to parts of Asia along the Asian trade routes is an excellent example of which of the followin
    10·2 answers
  • Kevin uses 32 ounces of dried apples and 18 ounces of dried cranberries to make a fruit snack. He plans to sell the snack in 1 2
    13·1 answer
  • A large, major hurricane is predicted to come ashore with its eye near the Louisiana/Mississippi border. You are asked to recomm
    10·1 answer
  • How long does it take for the moon to complete one revolution around Earth?
    14·2 answers
  • Who is most likely to have access to a computer and the internet?
    10·2 answers
  • Oceanic crust has a mafic composition and therefore is denser than continental crust.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!