All categories

3 years ago

What are the three ways that a school could address decrimination at school

2 answers:

5 0

Sexual discrimination if the assistant secretary finds it; for affirmative action to correct limited activity or program participation based on sex when there is no finding of discrimination; and for self-evaluation by educational institutions of their policies and practices regarding student admission, if the requirements are not met.

Combined 13 immigrant and bilingual education programs into a state formula program to provide greater accountability and flexibility. Its intent was to preserve existing emphases on helping school districts teach English to students with limited English-language proficiency (LEP) and helping those students meet the same state ELP standards as others.

It outlaws disability-based discrimination in public entities. This includes denying a free public education to students in elementary and secondary schools, and denying access to educational facilities and programs because of disabilities.

Ber [7]3 years ago

3 0

I’m sorry I really do t know. Wish I could help and hope u find an answer! Have a good day!!! :)

You might be interested in

Which of the following is a requirement for a population to be in Hardy-Weinberg equilibrium?

skelet666 [1.2K]

I think the answer is B. Immigration must outpace emigration. Hope this helps!

7 0

3 years ago

After glycolysis happens in the cytoplasm, where do the pyruvate molecules that were made from the food go for the next step in

Grace [21]

Answer:

Mitochondria

Explanation:

Pyruvic acid enters the mitochondria where in the presence of oxygen it is converted into acetyl coenzyme A. Acetyl coenzyme A joins the Krebs cycle in which it is broken down to carbon dioxide, water and energy which is used to produce ATP. ATP is a complex organic molecule.

4 0

3 years ago

What happens to predator populations when prey populations are scarce? Why?

GenaCL600 [577]

When prey is abundant, predator populations increase because more young are able to survive. More predators kill more prey, which, along with food scarcity, decreases the population. When prey becomes more scarce, the predator population declines until prey is again more abundant. Therefore, the two balance each other.

5 0

2 years ago

What ate the stages of meiosis of an animal cell

Gnesinka [82]

Answer:

Since cell division occurs twice during meiosis, one starting cell can produce four gametes (eggs or sperm). In each round of division, cells go through four stages: prophase, metaphase, anaphase, and telophase

Explanation:

4 0

3 years ago

Read 2 more answers

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago

What are the three ways that a school could address decrimination at school​

What are the three ways that a school could address decrimination at school