1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixer [17]
2 years ago
8

What is the impact of developing and using rock, mineral, and energy resources on earth's living and non living systems

Biology
1 answer:
77julia77 [94]2 years ago
6 0

Answer:  The use of rock, mining and energy production contaminates the environment by affecting the abiotic land mass. And therefore, by contaminating the habitat, the living beings that live there are harmed.

Explanation:

<u>Mineral and rock extraction, transport and processing comprise actions that produce environmental impacts because it produces a certain disturbance to the surface and underlying strata, as well as to aquifers</u>. These impacts can be short-lived, lasting as long as the mine is operational, or they can persist after mine development has been completed.

Major impacts include:

  • Contamination of soil, vegetation, drainages, rivers and groundwater aquifers contamination from leaking tailing piles and slurry ponds. If not properly treated, effluent from surface or subway mine water disposal can be highly acidic, and will contaminate surface waters and shallow groundwater with heavy metals, nitrates or oil from equipment, reducing local water supplies. During surface mining, movement and stockpiling of overburden, constructions or covering of soils alter rivers, drainages and coastal areas.
  • Surface disturbance caused by access roads, pits, and site preparation.
  • Noise and emissions from the operation of equipment.
  • Air pollution, atmospheric dust from traffic, excavation, drilling and site clearing. Atmospheric particulates come from blasting, excavation and earth moving, transportation or any operations that occur on the surface of subway mines.
  • Removal of rock strata can disrupt the continuity of the local aquifer, and cause interconnections and contamination between groundwater.

<u>Both surface and subway mining include a drainage of the mine area and discharge of mine water, the removal and storage/disposal of large volumes of waste and the transfer and processing of minerals or construction materials.</u> This requires the use of diesel or electric mining and haulage equipment. Transportation of ore within the mine area and to processing facilities may use trucks, conveyors, rail, polyduct or conveyor belt which are vehicles that emit large amounts of carbon dioxide.

Processing plants may be located in mountainous regions and so may have difficulty disposing of production wastes and other pollutants. <u>They may then end up disposing of them in rivers or coastal waters.</u>

The land at the surface of the mines will be unstable, there will be fracturing and subsidence, it will modificate soils, vegetation, rivers, wildlife habitat, wetlands, causing a temporary or permanent loss of land productivity, and <u>contamination of soils due to mineral materials and toxic substances</u>.

<u>Also, the production and use of energy is the main cause, together with transportation, of greenhouse gas emissions, the gases responsible for climate change</u>. Consequences of climate change are increased temperatures, rising sea levels and reduced rainfall.

The current model of generation, transport and consumption, <u>absolutely dependent on fossil fuels, is unsustainable</u>. The chemical products emitted, mainly from coal and oil-derived thermal power plants, are transported by the wind and deposited by rainfall thousands of kilometers away from their origin, causing "acid rain", which is <u>the cause of the deterioration and destruction of forests, lakes and other ecosystems</u>. Another example are the N<u>uclear power plants which produce high-level radioactive wast</u>e (long-lived, highly radioactive), which poses a constant threat to the environment due to the current inability to manage it.

Thus, the use of rock, mining and energy production contaminates the environment by affecting the abiotic land mass. And therefore, by contaminating the habitat, the living beings that live there are harmed.

You might be interested in
At night, clouds act as a blanket by _____.
PSYCHO15rus [73]
Absorbing outgoing radiation 
6 0
3 years ago
Read 2 more answers
Buzz bugs lay eggs that burrow into polar bear skin write any 2 adaptations which it can have (it’s urgent)
denis23 [38]

Answer: See explanation

Explanation: They could have cold resistances since they are being born in a cold climate.

3 0
2 years ago
A person has a condition that makes her bone weak and easily broken. what part of the bone is most likely the cause of this cond
emmainna [20.7K]

Answer:

d. bone marrow

Explanation:

6 0
3 years ago
Which question can be answered using the scientific process
Natali [406]
I believe it's the last question, How much water does it take to make a plastic bag?. 
3 0
3 years ago
Read 2 more answers
1. Did the direction the seed was facing change how the roots and stems grew? Include in your answer how the growth looked for e
Mice21 [21]
2.

The plant hormone auxin is the driving force behind the plant's growth towards the sunlight to be able to generate energy by photosynthesis. Highly sensitive light-sensing proteins help seedlings find the shortest route (to sunlight) by elongating the cells of the stem on the side that is farthest from the sunlight.

The roots are made up of cells that are dense with ball-like structures called statoliths that respond to  gravity pulling it down. It enables the plant to grow perpendicular to the sky.

4. 

Tropism is the plant's response to stimulus. When the plants move toward the stimulus, it is called a  positive tropism. Negative tropism is the plants' movement away from the stimulus. Both Phototropism and Geotropism are both tropisms.

Phototropism is the mechanism that enables the plant to respond to light. Stems and leaves exhibit this process.

Geotropism or Gravitropism the mechanism that enables the plant to respond to gravity. It allows the plant to orient themselves for growth. Plant roots exhibit this process.



4 0
3 years ago
Other questions:
  • What are the structures on the underside of fronds called in which the spores of ferns are produced?
    8·2 answers
  • Recently, Jonesville County inhabitants have been embroiled in a controversy regarding the use of pesticides on crops grown in t
    15·1 answer
  • Name the 7 peices of evolution and describe each.<br><br>10 POINTS
    13·1 answer
  • The volcanic landform that is formed when the more resistant volcanic pipe remains after most of the cone has been eroded is cal
    15·2 answers
  • What is meant by the uterus ............ for those who feel a girl please answer ...... ° _ ^​
    11·1 answer
  • An organism that makes its own food is called a
    14·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Why can't non vascular plant be larger?
    9·2 answers
  • I give you brilliant for this. I need independent and dependent variable:
    9·1 answer
  • how the cells in your body are different from one another. Look at the different types of cells above, and make a list of how th
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!