1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
3 years ago
6

you notice a sign in a parking structure that says "Warning: This area contains chemicals known to the state of California to ca

use cancer and birth defects or other reproductive harm". How can these harmful chemicals affect your DNA?
Biology
2 answers:
Brrunno [24]3 years ago
4 0
They can enter your blood stream (via breathing/ingesting) and once in your bloodstream they can enter cells and mutate your dna, which can cause cancer/birth defects/ reproductive harm
Arisa [49]3 years ago
4 0

Answer:

High-dose chemicals can damage DNA causing genotoxicity, which is defined as damage to DNA or genes. And this can be aggravated since many chemicals have had little toxicological evaluation.

Explanation:

The cancers are caused by mutations in the DNA throughout the life of a person, in such a way that obeying the causative factors, in this case the chemicals, they leave a mutational pattern in the genome of each tumor. There is an interesting biomarker called TGx-DDI, which is based on some genes that are expressed in a cell subjected to the stress produced by the chemical compound. These genes reflect the way in which different pathways can provide information on how cells respond to the chemical.

You might be interested in
The image of a scientist collecting a sediment core was taken at the Wild Harbor salt march on Cape Cod, Massachusetts. What evi
Inga [223]

Answer:

so what's your question?

6 0
3 years ago
Read 2 more answers
How can prokaryotes live without a nucleus?
xxMikexx [17]
I think because they have a DNA
5 0
3 years ago
Read 2 more answers
Sound wave vibrations are transmitted by three tiny bones located in the
Sauron [17]
Located in the Middle ear
8 0
3 years ago
Read 2 more answers
A student wonders whether removing the nucleus from a cell would result in a new prokaryotic cell. Why would this procedure fail
vichka [17]
A.) the cell would lack genetic information
5 0
3 years ago
Read 2 more answers
Which statements about the cycle of weathering, erosion, and deposition are true? Check all that apply. Deposition leads to the
Arturiano [62]

Answer:

b

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • When fatty acids cannot pack together tight enough to make a solid fat, they have ...
    7·1 answer
  • In prokaryotes the single DNA chromosome is a covalently closed dsDNA circle.  Replication starts at the:
    15·1 answer
  • Please help ASAP<br> Why are sea otters well suited for life in the kelp forest?
    12·1 answer
  • Sharon is working on a report on smooth muscles. Smooth muscles control involuntary body movements. Sharon drew this image to sh
    6·1 answer
  • What cell structure controls the flow of the water and sucrose into and out of the cell?
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • DISINS
    13·1 answer
  • 1. Refer to objective #11 ("Discuss how technology has improved our ability to find and use ocean resources.". If you visit the
    12·1 answer
  • What amount of chromosomes will each daughter cell have after mitosis and cytokinesis?
    10·1 answer
  • What causes multipcellualr organizms to grow?​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!