What are the different types of leaves that plants have?

Biology

1 answer:

dusya [7]3 years ago

7 0

Answer:

There are two different types of leaves – simples leaves and compound leaves. The other types of leaves include acicular, linear, lanceolate, orbicular, elliptical, oblique, centric cordate, etc. They perform the function of photosynthesis and help in the removal of excess water from the aerial parts of the plant. The most obvious aspect to examine is the shape of the leaf. If it is an uninterrupted shape, it is simple. If the shape divides into smaller leaf sets the leaf is compound. Identifying plant leaves that are compound divides them into subsets.

You might be interested in

Double fertilization in angiosperms is most similar to ______.

Sav [38]

Double fertilizer in a plant

3 0

3 years ago

Read 2 more answers

f humans and chimpanzees only differ by 1.2% genetically, why are there such sizable differences phenotypically between the two

dsp73

Answer:

the differnt dna and rna strucures in the mammals cause differen tlooks they have also evolved from being in the wilf most of their lives

Explanation:

5 0

3 years ago

After frida stops exercising she continues to breath heavily what is most likely to occur in her body

saveliy_v [14]

Hey :)

Strenuous exercise has caused her body to be in oxygen debt, and she is breathing hard while lactate is transported to the liver. This is a result of anaerobic respiration.

Hopefully this helped and good luck!!!

3 0

3 years ago

Single stranded with a helix shape

slega [8]

Answer:

Both A and B

Explanation:

Because RNA is single stranded and the DNA has a helix shape

5 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago