1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ket [755]
3 years ago
8

Where do these go plz someone help​

Biology
1 answer:
goldfiish [28.3K]3 years ago
7 0

Answer:

toooo blurryyyy post another pic but clear

Explanation:

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Where should the biosphere label appear in the system model? Use reasoning to explain your answer.
Leto [7]

Answer:

Biosphere is the one of the sphere of geological sphere of the earth such as geosphere, hydrosphere and atmosphere. It is deal with the interaction and existence of the living organisms.

In this model it can be seen that there are human, fishes, and vegetation of plants are living organisms so living organisms in the hydrosphere (fishes), geosphere (plants) and anthrosphere (human) should be label as biosphere instead of atmosphere or with atmosphere.

4 0
3 years ago
In which Colorado Rockies scenario was there more erosion? Why was there more erosion in the scenario?
Pavlova-9 [17]

Answer:

There was more erosion in the Colorado Rockies scenario where there was steady rain compared to the scenario in the same area where there was only a drizzle. There is more erosion because the steady rain increased the volume of the river more than the drizzle did. Because there was more water added to the river, the river flowed faster. The faster a river flows, the more sediments it transports or erodes.

Explanation:

hope this helps<3

8 0
2 years ago
Read 2 more answers
All of these are true about surface runoff EXCEPT: *
Triss [41]

Answer:

D

Explanation:

Using the eliminating method, all the others are true of surface runoff, so they are not correct answers. So, that means D must be correct.

7 0
3 years ago
Where is the fluid that the lymphatic system collects returned to the blood?
Radda [10]
Your heart, answer.A
5 0
3 years ago
Read 2 more answers
Other questions:
  • How do scientists know that humans originated in Africa?
    13·1 answer
  • A woman gives birth to a small infant with a malformed skull. the infant grows abnormally slow and shows signs of substantial co
    15·1 answer
  • What the elements for nucleic acid someone?
    13·2 answers
  • Sam wants to demonstrate how water changes from a solid to a gas. He places ice in a pot on a stove. What variable is causing wa
    7·1 answer
  • Colorblindness is a sex-linked trait. A mother with normal vision and a man who is colorblind have a colorblind daughter. What s
    6·2 answers
  • Match the following terms and definitions. 1. electrically charged atom or group of atoms formed by the loss or gain of electron
    14·1 answer
  • You have discovered the fossil remains of three organisms. One is
    15·2 answers
  • 3. Identify the stages of these cells
    15·1 answer
  • In the diagram of the human digestive system, what organ is labelled 5?
    14·1 answer
  • How many electrons does this isotope of titanium have?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!