1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
astraxan [27]
3 years ago
10

When certain molecules accept and then donate electrons, they also pick up H+ ions in the matrix, then release them into the int

er membrane space.
As H+ diffuses back into the matrix through ATP synthase, its passage drives the phosphorylation of ADP to ATP. This process is called.............
A.Chemiosmosis
B.Electron Transport Chain
C. Synthesis of ATP
D.ADP phosphorylation
Biology
1 answer:
11Alexandr11 [23.1K]3 years ago
4 0
The answer is going to be A
You might be interested in
Which hydrocarbon rings are most common in nature?
UNO [17]
The Aromatic hydrocarbon is the most common in nature.
4 0
3 years ago
According to the diagram of the water cycle, what happens to the water in the oceans before it becomes water in the atmosphere?
lions [1.4K]
I believe the answer is that it condenses. 
7 0
3 years ago
Read 2 more answers
HELPPPPPPP
postnew [5]
The first diagram is the alpha helix, which is a spiral shape.

The second diagram is the beta pleated sheet which is the folded paper shape
4 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
After fertilization, the ovule develops into a seed. can you match the parts of the ovule with the corresponding parts of the se
Goshia [24]
After fertilization of the ovule, the megaspore develops into the food supply of the mature seed.
After fertilization of the ovule, the <em />integument develops into the seed coat.
After fertilization of the ovule, the fertilized egg develops into the embryo of the mature seed. 

The ovule contains the female reproductive cells of the seed plants and when fertilized, it produces the seed. Ovules contain megasporocytes, cells that produce megaspores through cell division. An integument is a layer that protects and surrounds the ovule. After fertilization, the integument protects and surrounds the seed. After fertilization, the ovule contains a diploid zygote which develops into an embryo.
8 0
3 years ago
Other questions:
  • _________________________are organisms that produce their own organic molecules for energy and nutrition using energy from light
    7·1 answer
  • The electrons in the outermost energy level are called........?
    5·2 answers
  • Groundnut and sunflower seeds are sources of
    9·1 answer
  • The iris in the human eye contracts and expands, controlling the amount of light that reaches the retina. What types of muscle c
    11·1 answer
  • List the kind of features you might expect to see near the edges of plates like these 2 plates that are coming together.
    6·1 answer
  • Describe the advantages of a four chambered heart compared to heart with two or three chambers
    12·1 answer
  • HELP!!! Can Someone Answer The Atomic Mass And Atomic Number Worksheet, Please I Will Give Thanks To Anyone Who Can Figure This
    6·1 answer
  • Why is it possible that two ecosystems with identical conditions of temperature and precipitation, could support different plant
    15·1 answer
  • Plsss help me Asap!!!!​
    6·1 answer
  • Plz answer question.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!