1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
3 years ago
12

Which of the following is a testable hypothesis?

Biology
2 answers:
Zina [86]3 years ago
8 0
<h3><u>Answer;</u></h3>

C. Common house spiders need to eat insects to live.

<h3><u>Explanation;</u></h3>
  • <em><u>A hypothesis is a tentative prediction or explanation of the relationship between two or more variables.</u></em>
  • <em><u>A testable hypothesis is a hypothesis that can be proved or disproved as a result of testing, data collection, or experience. </u></em>
  • A testable hypothesis must be a relational statement between two or more variable. It should include phrases such as "more than", "less than", "greater than", "different from", or "related to". It also must be justifiable that is consistent with an existing body of research findings.
Ne4ueva [31]3 years ago
5 0
C i think . Hope this helps
You might be interested in
A homozygous tall (dominant) pea plant is crossed with a short (recessive) plant. The probability that an F1 plant will be tall
Masteriza [31]
The answer would be B- 25%
7 0
3 years ago
Which of the following protist groups correctly completes the sentence below?
Schach [20]

Amoeba are the consumers that surround, engulf, and ingest their food.

<h3><u>Explanation</u>:</h3>

Amoeba is a unicellular organism that belongs to the kingdom Protista. This organism are having eukaryotic cells without any cell walls. These organisms have each and every cellular organelle that are needed to perform metabolism.

Amoeba are consumer in mode of nutrition. Whenever they senses some food, they push a part of their cytoplasm packed in cell membrane towards the food to cover it. This process is called pseupodia.

This pseupodia engulfs the food and performs phagocytosis or pinocytosis. This food is covered in a cell membrane inside the cytoplasm which is called the food vacoule or endosome. This then fuses with a lysosome to digest and then the excretory product is let off by the secondary vacoule.

8 0
3 years ago
Read 2 more answers
How can heredity and the environment interact to influence the cell cycle?
-BARSIC- [3]

From the earliest moments of life, the interaction of heredity and the environment works to shape who children are and who they will become.

The complex interaction of nature and nurture does not just occur at certain moments or at certain periods of time; it is persistent and lifelong.

8 0
3 years ago
In the process of meiosis, which step explains the probability that a particular allele will be in a gamete?
Ksju [112]

Answer:

Answer is Option B

Explanation:

<em>Chromosome</em><em> </em><em>segregation</em>

<em><u>maybe </u></em><em><u>this </u></em><em><u>might </u></em><em><u>be </u></em><em><u>ur </u></em><em><u>answer </u></em>

4 0
3 years ago
Areas of the Earth near the equator receive large amounts of solar energy. How does this lead to increased rainfall?
pickupchik [31]

Answer:

D

Explanation:

The heat will make water evaporate at a higher rate thus causing more rain

6 0
3 years ago
Other questions:
  • Within a double-stranded dna molecule adenine , forms hydrogen bonds with thymine and citizens forms hydrogen bonds with guanine
    5·1 answer
  • What do artists and scientists have in common
    8·1 answer
  • What is the proton gradient used for in photosynthesis?
    14·1 answer
  • Organisms which lack proper adaptations may die...true or false​
    8·2 answers
  • How do atoms become the complex structures and substances around us
    15·1 answer
  • Which features of the ocean floor are found in the open ocean? Check all that apply.
    11·2 answers
  • Caulfield,
    9·1 answer
  • 20 Points!!!! Answer ASAP!!! Describe the process of oil extraction in complete sentences. Be sure to include information about
    14·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Disinfection is important in killing any remaining bacteria or pathogens in the wastewater. True False
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!