1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EastWind [94]
3 years ago
6

What is one way to separate a substance that is dissolved in water?

Biology
2 answers:
Illusion [34]3 years ago
7 0

Answer:

Mixtures can be separated using a variety of techniques. Chromatography involves solvent separation on a solid medium. ... Evaporation removes a liquid from a solution to leave a solid material. Filtration separates solids of different sizes.

victus00 [196]3 years ago
6 0

1. Handpicking

2. Threshing

3. Winnowing

4. Sieving

5. Evaporation

6. Distillation

7. Filtration or Sedimentation

8. Separating Funnel

9. Magnetic Separation

9 ways to seperate substances disolved in water.

You might be interested in
A scanning electron microscope is a type of light microscopes that has more than one lens
timurjin [86]

Answer:

true

Explanation:

the condenser lens is the size of the electron beam and the main objective lens is to focus the beam on the sample

so that scanning electron microscope have two projector lens

sorry if its not correct

5 0
3 years ago
HELP!!! MARKING BRAINLIEST
STALIN [3.7K]

Answer:

6.) The stroma!

7.) Wavelengths of 430nm(blue) and 662nm(red). <em>( It reflects green light strongly so it appears green to us. :) )</em>

8.) Glucose is used by plants for energy and to make other substances like cellulose and starch. <em>(Cellulose is used in building cell walls.)</em>

9.) Animals either eat plants to obtain chemical energy in the form of glucose or they eat other animals that ate plants. So, energy moves from the Sun to plants to animals. Animals also use oxygen released by the plants to breathe.

3 0
3 years ago
How many hydrogen bonds connect a cytosine to an guanine
Serjik [45]

Answer:

3

Explanation:

Three hydrogen bonds....

"Cytosine and guanine pairing can be found in both DNA and DNA-RNA hybrid formed during replication and transcription. The two nitrogenous bases are held together by three hydrogen bonds."

6 0
3 years ago
Why does an enzyme only acts on a specific substrate ?
oksian1 [2.3K]

Answer:

Enzymes have specific sites which are known as the active sites. The shape of the active sites is specific for specific kinds of substrates. This allows every enzyme to be specific for its action. Only the specific substrate will be able to fit into the active site and hence, activate the enzyme. The presence of active sites makes the activity of each enzyme specific and hence, every enzyme is able to catalyze a specific kind of reaction.

7 0
3 years ago
The origins of the levator scapula are from the ___________ of four cervical vertebrae. spinous processes fascia transverse proc
Charra [1.4K]

Answer:

posterior tubercle

Explanation:

5 0
3 years ago
Other questions:
  • Organiza los siguientes indicadores de calidad de vida que plantea el Instituto Nacional de Estadística y Geografía (Inegi). Seg
    14·1 answer
  • What is exocytosis and endocytosis? Think about what the words sound like.
    9·1 answer
  • How does replication ensure that cells have complete sets of DNA
    12·1 answer
  • Evolution happened millions of years ago but is not happening now. true or false? If true give a reason why if false give a reas
    8·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Which level of organization is formed from two or more different tissues that group together and perform a function? (4 points)
    5·1 answer
  • Peanut plants have 40 chromosomes. How many CHROMATIDS will there be when meiosis begins? *
    7·1 answer
  • Mary pushes her cart across the floor with a force of 150N for a distance of 10m. What is the work done on the cart?
    7·1 answer
  • What errors that could take place if a cell in m phase and g phase combine
    14·1 answer
  • What have we learned from fossil evidence about evolution?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!