1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisov135 [29]
3 years ago
7

Please help meeeeeeeeeweewwwwweeeeee

Biology
1 answer:
scZoUnD [109]3 years ago
4 0

Answer:

the answers are D, E and G

Explanation:

You might be interested in
WILL GIVE BRAINLIEST
Naily [24]
They are planets that is made up of rocks or metals
8 0
3 years ago
What happens after activation of T cells<br>​
NikAS [45]

Answer:

Helper T cells are arguably the most important cells in adaptive immunity, as they are required for almost all adaptive immune responses. They not only help activate B cells to secrete antibodies and macrophages to destroy ingested microbes, but they also help activate cytotoxic T cells to kill infected target cells.

Explanation:

Helper T cells become activated when they are presented with peptide antigens by MHC class II molecules, which are expressed on the surface of antigen-presenting cells (APCs). Once activated, they divide rapidly and secrete cytokines that regulate or assist the immune response.

8 0
3 years ago
Choose the correct connective tissue.
PSYCHO15rus [73]

Explanation:

A tendon is a fibrous connective tissue which attaches muscle to bone. Tendons may also attach muscles to structures such as the eyeball. A tendon serves to move the bone or structure. A ligament is a fibrous connective tissue which attaches bone to bone, and usually serves to hold structures together and keep them stable.

6 0
3 years ago
Read 2 more answers
Identify two common ways of expressing a changing speed
Lelu [443]

Answer:

Speed has the dimensions of distance divided by time. The SI unit of speed is the metre per second (m/s), but the most common unit of speed in everyday usage is the kilometre per hour (km/h) or, in the US and the UK, miles per hour (mph). For air and marine travel the knot is commonly used.

Explanation:

8 0
3 years ago
Which event occurs during prophase?
solong [7]
The spindle fibres form 

brainliest hope this helps

5 0
3 years ago
Read 2 more answers
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • When the base of a glacier melts and refreeze it will likely pick up some rocks this process is called ?
    9·2 answers
  • Imagine that a taxonomist is provided with several flashcards on which the names of different species are written. She would lik
    5·1 answer
  • Tasha is on medication that requires the pH of the stomach and makes it alkaline what is the effect of this medication
    14·1 answer
  • PLEASE ANSWER FAST!!!
    13·2 answers
  • The first stage in the formation of coal is
    12·2 answers
  • The chart above shows the lowest pH level at which four different types of organisms can survive. These organisms live in Lake B
    10·2 answers
  • Plz help this is due today. plz dont copy and place from the internet
    9·2 answers
  • Suppose we have one true-breeding strain of tomato that produces red fruit. Suppose we also have a true-breeding strain of tomat
    5·1 answer
  • The role of dna in cellular differentaation
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!