1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
likoan [24]
2 years ago
10

Which would make for a weak claim?

Biology
2 answers:
levacccp [35]2 years ago
6 0

Answer:

A blog cited as a source

Explanation:

Blogs often contain opinions rather than facts

Burka [1]2 years ago
5 0

Which would make for a weak claim?

<u>1. a blog cited as the source </u>

2. a large sample size

3. clear variables and controls

4. multiple trials

You might be interested in
dune grasses help hold the sand of the sand dunes in place. the grasses can survive in high winds and flooring. what feature of
photoshop1234 [79]
Beach grasses help keep the plants in place
6 0
2 years ago
11. Migration is a<br> adaptation.<br> Natural <br> Behavioral <br> Structural <br> Functional
chubhunter [2.5K]

Answer:

behavioral adaptation

3 0
3 years ago
Read 2 more answers
Gravity is the force of ______ between all objects.
Rudiy27

Answer:

Gravity is a force of attraction that exists between any two masses, any two bodies, any two particles. Gravity is not just the attraction between objects and the Earth. It is an attraction that exists between all objects, everywhere in the universe.

or just mass.

The Law of Universal Gravitation states that the force of gravity acts between all objects in the universe that have mass.

8 0
3 years ago
Illustrate the differences between prokaryotic and eukaryotic cells.​
vlabodo [156]

Answer:

prokaryotic are unicellular organisms

eukaryotic are multicellular

Prokaryotic need only one parent to reproduce

Eukaryotic need 2 parents to reproduce

Explanation:

4 0
2 years ago
What are three populations commonly found in the prairie ecosystem
harina [27]
The best answer to your question is large headed grasshoppers, prairie dogs, and blue grama
3 0
3 years ago
Other questions:
  • The Jackson Prairie is a temperate grassland region in Mississippi, spread over an area of fertile soil. What could be a reason
    6·1 answer
  • Nucleotide bases bonded to a sugar phosphate backbone make up
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which aspect of a chemical reaction is affected by enzymes?
    14·2 answers
  • During which phase of mitosis do nuclear envelopes and the nucleoli reappear?
    5·1 answer
  • A scientist performs an experiment. His results do not support his hypothesis. Which of these should the scientist do?
    7·1 answer
  • Wanna zoooooooooooooooooooooooooom?<br><br> Meeting ID: 948 4980 6988<br> Passcode: 8t7Nva
    7·1 answer
  • Plz plz plz help Scientists rejected Wegener's theory because he could not _________________________.
    13·1 answer
  • A population of alligators
    12·1 answer
  • Which of the amino acids could form a hydrogen bond with another amino acid in the chain?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!