1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ierofanga [76]
3 years ago
7

Hudson and Montoya Coal Company Inc. has an electrostatic precipitator that is no longer functioning properly. If it is not fixe

d which law are they in danger of violating?
Which act is it?


A. Superfund act
b. Nuclear Waste policy act
c. Clean air act
d. Clean water act
Biology
1 answer:
kolezko [41]3 years ago
8 0
The answer to this question is A superfund Act
Your welcome :)
You might be interested in
The ovaries are small organs that produce egg cells in females. Removal of
nlexa [21]

Answer:

B

Explanation:

if you were a female and had this done to you, you would then understand.

3 0
3 years ago
Learning Task 3
lara [203]

The purpose of both mitosis and meiosis is to increase the number or population of cells in the body.

<h3>Compare mitosis and meiosis type of cell division</h3>

Mitosis produces two diploid (2n) cells that are identical to the original parent cell whereas meiosis produces four haploid (n) cells that are different from the original parent cell.

Mitosis occurs in somatic cells whereas meiosis occurs in reproductive cells.

So we can conclude that the purpose of both mitosis and meiosis is to increase the number or population of cells in the body.

Learn more about mitosis here: brainly.com/question/19058180

5 0
2 years ago
Healthy soil depends on _______. a. the size of rock particles b. oxygen content c. moisture content d. all of the above
aivan3 [116]

d boiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii

4 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
What is the natural nutrient enrichment of a shallow lake, estuary, or slow moving stream called? A .oligotrophy
kaheart [24]

Answer:

Eutrophication

Explanation:

Eutrophication is the name given to the natural nutrient enrichment of a shallow lake, estuary, or slow-moving stream. It is caused mostly by runoff of plant nutrients, such as nitrates and phosphates, from surrounding land.

3 0
3 years ago
Other questions:
  • Teens typically experience a burst of cortical gray matter growth at puberty, followed by a wave of gray matter loss extending i
    12·1 answer
  • The level of glucose in the blood is kept within a very narrow range. A blood glucose level outside of this range stimulates the
    5·2 answers
  • Several genes control human eye color. because of this, eye color shows a continuous variation from very dark brown to green to
    14·1 answer
  • The carbon, water, and nitrogen cycles are important in keeping living organisms functioning properly. True or False?
    15·1 answer
  • Other than bacteria, which factor leads to nitrogen fixation
    8·2 answers
  • A client is receiving an intravenous infusion of 1000 mL of normal saline with 40 mEq of potassium chloride. The care unit is mo
    14·1 answer
  • How could an error during transcription affect the protein that is produced?
    14·2 answers
  • Emily is developing a computer model of protist populations in certain areas of the ocean, and how they help maintain homeostasi
    9·1 answer
  • What do the results of the agar blocks indicate about the relationship between cell size and diffusion rate
    14·2 answers
  • Homeostasis is the regulation and maintenance of a stable internal environment of an organism to support life at the cellular le
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!