Answer:
c. the high-energy phosphates stored in muscle cells
Explanation:
Phosphocreatine (PC) or creatine phosphate is a compound rich in energy. It has energy stored in it which can be used to phosphorylate ADP into ATP. The phosphocreatine is stored in muscle cells when muscles are not working. The produced ATP serves as an energy source for muscle contraction. The creatine produced during ATP production is phosphorylated again into PC using ATP when muscles are resting.
Answer:
What is population?
A group of organisms of different species interacting with each other and the environment is called populatin.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
In <u>asexual </u>reproduction, genetically identical offspring are produced, while in <u>sexual </u>reproduction, offspring are genetically different from each other.
Sexual reproduction is a sort of reproduction that involves a complex existence cycle wherein a gamete (inclusive of a sperm or egg mobile) with an unmarried set of chromosomes (haploid) combines with another to provide a zygote that develops into an organism composed of cells with two sets of chromosomes (diploid).
Sexual reproduction is the maximum common existence cycle in multicellular eukaryotes, which includes animals, fungi, and plants.
Asexual reproduction is a sort of reproduction that doesn't involve the fusion of gametes or change in the number of chromosomes. The offspring that get up by asexual reproduction from both unicellular and multicellular organisms inherit the whole set of genes in their single parent. Asexual reproduction is the number one shape of reproduction for single-celled organisms including archaea and bacteria.
Learn more about Sexual reproduction here: brainly.com/question/815744
#SPJ4
The cell uses oxygen in the mitochondria which produces energy, without it the mitochondria makes lactic acid. Lactic acid affects muscles, and causes muscle soreness. That is if the cell is lacking oxygen, if it didn't get oxygen at all i would think that the affects on the body would be more severe.
