I would say its C but im not for sure
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Ionizing radiation, for example X-rays, gamma rays and alpha particles
Answer:
0.27m
Explanation:
To get the energy
Potential energy= Mgh
M is Mass
G is acceleration due to gravity
H is height..
M= 0.29kg, h= ?
P=0.759. g=9.8m/s
Therefore,
0.759=0.29×9.8×h
H= 0.759÷2.842
H= 0.27m