1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cerrena [4.2K]
2 years ago
6

Helpppppp!!!

Biology
2 answers:
Julli [10]2 years ago
3 0
I believe the answer is adrenaline, the rest just dont make sense
miss Akunina [59]2 years ago
3 0

Answer:

Adrenaline is an example of a hormone. Hormones are chemical messengers in your body, which carry around messages. Adrenaline is a hormone that is released when you are in fear, stress, or doing something dangerous.

Let me know if this helps!

You might be interested in
Water evaporates from Earth and then cools and returns to Earth as
arlik [135]
I would say its C but im not for sure
3 0
3 years ago
Read 2 more answers
Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i
Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

7 0
2 years ago
Which of the following is not an example of nonpoint source pollution
bogdanovich [222]

sewage treatment

have a great  day

3 0
3 years ago
List three examples of mutagens.
NikAS [45]
Ionizing radiation, for example X-rays, gamma rays and alpha particles
8 0
3 years ago
A frog with a mass of 0.29kg hops up in the air. At the highest point in the hop, the frog has a gravitational potential energy
PtichkaEL [24]

Answer:

0.27m

Explanation:

To get the energy

Potential energy= Mgh

M is Mass

G is acceleration due to gravity

H is height..

M= 0.29kg, h= ?

P=0.759. g=9.8m/s

Therefore,

0.759=0.29×9.8×h

H= 0.759÷2.842

H= 0.27m

8 0
3 years ago
Other questions:
  • Fungal hyphae that create essentially one giant cell containing many nuclei would be described as what? Coenocytic, cyclosporic,
    15·2 answers
  • How are unicellular and multi cellular organisms alike/how are they different
    10·1 answer
  • Who is the scientist credited with organizing living things?
    8·1 answer
  • What characteristic of earth results in different season over a period of a year
    5·2 answers
  • The following table describes some biotechnological processes.
    11·2 answers
  • How many carbon atoms are in starch
    8·2 answers
  • Seeds contain not only a complete plant embryo, but they also store food to provide energy for the germination and early develop
    10·2 answers
  • GIVING BRAINLIEST!!!!!
    6·1 answer
  • Select ALL the functions of the digestive system
    5·1 answer
  • Why does the nurse need to keep the urine sterile while obtaining a sample from an indwelling urinary catheter?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!