1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
levacccp [35]
3 years ago
15

What are constituents of chromosome?​

Biology
1 answer:
k0ka [10]3 years ago
7 0

The major chemical components of the chromosome are DNA, RNA (nucleic acids), and proteins (histones and nonhistones).

Hope it helps you

Mark my answer as brainlist

have a nice day

You might be interested in
Briefly explain why experiments having faulty design or inconsistent data are problems for scientists. List several reasons.
Montano1993 [528]
First things first, what do you think? Do you have any reasons of your own? We can go from there...

7 0
3 years ago
Read 2 more answers
How do you compare yourself now from before​
Dima020 [189]
I was young, now I’m old
4 0
3 years ago
The _________________________ are responsible for packaging and distributing the materials in a cell. * Fill in the blank(s) wit
Natali5045456 [20]
Red blood cells I think!
6 0
3 years ago
The development of organs and tissues from a zygote includes?
laiz [17]
The answer is the letter a
5 0
4 years ago
Read 2 more answers
Because insulin and _____ are secreted in the bloodstream in equal amounts, ____ can be used as a clinical indicator of endogeno
lesya [120]

Answer:

c-peptide

Explanation:

Insulin is an hormone in our body which is produced by pancrease's beta cells. Insulin helps in regulation of blood sugar level. It helps body to use glucose taken through meal or store glucose for further future activities. Insulin is made up of peptide chains bonded by di sulfide bond and when the two chains separates C-peptide is released.

5 0
4 years ago
Other questions:
  • What results if a fragment of a chromosome breaks off and then reattaches to the original chromosome at the same place but in th
    15·1 answer
  • In plants, the process of photosynthesis produces what?
    9·1 answer
  • Which one of the following molecules would be most likely to travel by facilitated diffusion? A. sodium ions B. glucose C. oxyge
    6·2 answers
  • Both the consumption of alcohol and the ingestion of antianxiety drugs work to increase the activity of __________, which is an
    11·1 answer
  • ( I really need help on this)A compound microscope uses
    10·1 answer
  • Read this excerpt from "The Big Shot."
    10·2 answers
  • New weapons system is about to come online. Some components covered by the current security classification guide will need to ha
    5·1 answer
  • Match the organism with its place on the cladogram
    13·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Many scientists are worried that the increased amount of carbon dioxide in Earth's atmosphere will _____
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!