1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Makovka662 [10]
3 years ago
15

Reflection:

Biology
1 answer:
Gnoma [55]3 years ago
7 0

Answer:

Explanation:

Need to Know. How are you creating a need to know the content that is recorded? Just because I record something, or use a recorded material, does not mean that my students will want to watch, nor see the relevance in watching it.

Engaging Models. One of the best way to create the "need to know" is to use a pedagogical model that demands this. Whether project-based learning (PBL), game-based learning (GBL), Understanding by Design (UbD), or authentic literacy, find an effective model to institute in your classroom.

Technology. What technology do you have to support the flipped classroom? What technology gaps exist that might hinder it? Since the flipped classroom is about recorded video, then obviously students would need the technology to do this.

Reflection. Every time you have students watch a video, just like you would with any instruction

You might be interested in
An organism does not have a nucleus, carries on photosynthesis, and is very common. It is probably a
kirza4 [7]
Some form of plant life. It could be a tree, flower, even a simple blade of grass.
8 0
3 years ago
Read 2 more answers
The table below lists information about different types of bacteria.
hodyreva [135]
What table ? We can’t help because we can’t see what information was provided on the table
4 0
3 years ago
Read 2 more answers
What does the limbic system do? connects the brain and the spinal cord directs incoming sensory messages coordinates involuntary
Rashid [163]

registers feelings, such as fear and pleasure


5 0
3 years ago
How did the geography and climate of the plains affect the native American there HELP PLEASE
Yakvenalex [24]

Deep canyons, steep cliffs, rugged mountains. Dry, rocky environment. Little rainfall so few trees. Influenced the kinds of homes built. (Used stones, mud, bricks, etc.)

Farming methods.

6 0
3 years ago
Identify the structures in the cell pictured on the right<br> Label a,b,c,and d<br> 30 points
yulyashka [42]

The labeling of the cell represents.

The label A is Nucleus: The nucleus of the cell carries the hereditary material DNA from one generation to another generation. This carries the traits from one generation to another.

The label B is Cytoplasm: This is the fluid part of the cell which has all the organelles floating in it.

The label C is ribosomes: It is the an organelle present in that that is responsible for the protein synthesis.

The label D is Nucleolus: It is known to be the largest structure in the nucleus of the eukaryotic cell. It helps in the signal recognition pathway.

3 0
3 years ago
Read 2 more answers
Other questions:
  • In your own words, describe the base-pairing rules in any DNA molecule.
    14·2 answers
  • PLEASE HELP ME !!!!
    9·2 answers
  • Instructions for development that are passed from parent to off spring are known as
    5·1 answer
  • An abnormal change in ph or increase in temperature could cause the enzyme to _____________. denature speed up remain active wit
    13·1 answer
  • Hey guys please help with these questions. 1. If we get genetic information from both parents, why do some of my traits come fro
    15·1 answer
  • A mass extinction, in which the dinosaurs disappeared from Earth, occurred approximately ____ years ago.​
    10·1 answer
  • True or false
    14·1 answer
  • The unusual strength of a glue makes it able to hold a heavy object, or load, as shown in the diagram below.
    14·2 answers
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • Wrong answers only!! What are 3 sustainable tourism takes into account
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!