1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leto [7]
3 years ago
14

WHAT IS BREEDING DEFINATION

Biology
1 answer:
Luden [163]3 years ago
8 0

Answer:

Breeding is sexual reproduction that produces offspring, usually animals or plants.

Explanation:

make me as brainleast.

You might be interested in
What role does air pressure play in weather conditions?
mixer [17]
It’s the first one. “It’s force determines..”
6 0
2 years ago
PLZ HELP HURRY ASAP
stich3 [128]

The Answer You Are Looking For is "C" , exons (:

-Jojo

4 0
3 years ago
Read 2 more answers
Why do scientist need a common system of measurement
Natali5045456 [20]
Because science involves a lot of replication to confirm results. That means without the systems, it would take a long time to get the results right.
8 0
2 years ago
Read 2 more answers
Which homeostatic process requires energy to move particles across the plasma membrane?
Pani-rosa [81]
Active transport requires energy because unlike osmosis and diffusion which are passive transport methods which sees where the particles are moving along the concentration gradient, in active transport, the particles are moving against the concentration gradient and as such energy through ATP is needed for the particles to be transported.
4 0
3 years ago
Read 2 more answers
List all four body systems that make up the excretory system and give an example of how each body system eliminates waste.
mart [117]

Answer:

Organs of excretion make up the excretory system.

They include the :

kidneys-Blood by-products are filtered out by the kidneys and leave the body in urine form. They are part of the urinary system, which also includes the ureters, bladder, and urethra

large intestine-By-products enter the intestine and leave the body in the form of feces

liver- breaks down harmful substances. It's by-products are excreted into bile or blood.

skin-Sweating eliminates excess water and salts, as well as a small amount of urea, a byproduct of protein catabolism

lungs- oxygen is exchanged for a waste gas called carbon dioxide. Your bloodstream then carries this waste gas back to the lungs where it is removed from the bloodstream and then exhaled

Hope this helps!!!!!!

Forever friend and helper,

Cammie :)

4 0
3 years ago
Other questions:
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The nursing student identifies which people as qualifed to administer anesthesia?
    13·1 answer
  • What would happen if the parent cell were to divide more times than usual during mitosis
    14·1 answer
  • In birds, having long feathers (L) is dominant to short feathers (l). A homozygous dominant bird and homozygous recessive bird m
    12·1 answer
  • Someone help me pls
    9·2 answers
  • What causes tides?
    6·2 answers
  • .
    14·1 answer
  • How will genome projects contribute to better productivity in cattle?
    9·1 answer
  • The center of our galaxy contains a very intense source of radio and x-ray radiation named sgr a*. what is it about this source
    5·1 answer
  • QUESTION:
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!