1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
poizon [28]
3 years ago
7

Pathogen A has an ID50 of 50 particles, pathogen B has an ID50 of 1,000 particles, and pathogen C has an ID50 of 1 × 106 partic

les. Which pathogen is most virulent?
pathogen A
pathogen B
pathogen C
Biology
1 answer:
klemol [59]3 years ago
6 0

Answer:

Option A, pathogen A

Explanation:

ID50 is a way to measure the virulent efficiency of a pathogen. ID50 for a pathogen depicts the number of pathogens required to infect or cause the associated disease with in 50 percent of any population sample.

This means that 50 pathogens A can infect 50 percent  of any sample population.

While 1000 pathogen B and 1000000 pathogen C are required to infect 50 percent  of any sample population.

hence, Most virulent pathogen is Pathogen A

You might be interested in
A species can withstand a narrow range of temperature. Above 100°F there are no species present. In the range from 97°F to 100°F
Troyanec [42]

Answer:

zone of physiological stress

7 0
3 years ago
Which of the following structures is part of the vascular tunic
Mama L [17]
The answer is "iris".
7 0
3 years ago
which refers to the maintenance of a stable internal environment despite changing external conditions? A.differentation B. self-
Vladimir79 [104]
<span>C, Homeostasis is the quality of organisms that describes their ability to maintain internal conditions in a stable manner amid external conditions that change at certain times and periods. It is the way to keep in balance in environment and environment.</span>
4 0
3 years ago
Read 2 more answers
which of the following statements is true about Charles Darwin? A. He supported Lamarck’s theory of evolution. B. He believed ev
elena55 [62]

Answer:

He supported Lamarck’s theory of evolution.

5 0
2 years ago
Read 2 more answers
Connects two dna strands by forming a bond between the phosphate group of one strand and the deoxyribose group on another
Maslowich

Answer:

DNA Ligase

Explanation:

DNA ligase is an enzyme that connects nucleotides of DNA from the phosphate to the sugar.  This seems to match the provided description, therefore I believe it to be the correct answer.

7 0
3 years ago
Other questions:
  • Please help..<br> Thanks
    11·2 answers
  • After duplication, at what point does a cell become two cells with identical DNA? starting in prophase end of anaphase end of cy
    14·1 answer
  • We have talked about the central and peripheral nervous systems. We know that the peripheral nervous system relays signals to an
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Why do black redstarts exhibit migratory restlessness at night for fewer days than common redstarts?
    10·2 answers
  • A fly has two alleles for the color of its eyes. The green allele is recessive, and
    14·2 answers
  • A person infected with the human immunodeficiency virus may have any symptoms for a period of time. During this period, the viru
    13·1 answer
  • A force is a push or pull that is described by its
    9·1 answer
  • Define the term developed nation
    6·1 answer
  • What happens to the water backed off of Lake Missoula
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!