All categories

3 years ago

Which of these would help dissolve a solid into a liquid faster?

Biology

2 answers:

mixer [17]3 years ago

6 0

Answer:

lowering it's temperature

Explanation:

i guess because hotter it is the note liquidy

Nikitich [7]3 years ago

5 0

Answer:

D. stirring or shaking the mixture

You might be interested in

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

2 years ago

Molecules move from greater to lesser concentration through a transport protein in

PilotLPTM [1.2K]

Facilitated diffusion

<span>The word 'diffusion' means free movement across distance, with or without the presence of a barrier. However, there is a phenomenon known as facilitated diffusion which occurs at the cellular level. The cell does not allow free radicals and other harmful substances to enter and harm the cell organs. This is possible due to the structure of the cell membrane. The structure is such that, it allows only certain things to pass in and out of the cell. One such activity that allows selective movement in and out of the cell is the process of facilitated diffusion.</span>

6 0

3 years ago

The fish pond are dying because of algal bloom. Algal bloom is caused by the presence of excess phosphorus or sulfur in the pond

Masja [62]

D is the only logical answer

7 0

2 years ago

Tell me the answer for everythink

natita [175]

Question:why were maggots there only after the flies left
Hypotheses:the maggots are fly larva

4 0

3 years ago

Read 2 more answers

Cellular respiration map

nexus9112 [7]

Explanation:

Respiration in the mitochondria utilizes oxygen for the production of ATP in the Krebs’ or Citric acid cycle via the oxidization of pyruvate (through the process of glycolysis in the cytoplasm).

overall: C6H12O6 (glucose) + 6 O2 → 6 CO2 + 6 H2O + ≈38 ATP

Further Explanation:

In all eukaryotic cells, mitochondria are small cellular organelles bound by membranes, these make most of the chemical energy required for powering the biochemical reactions within the cell. This chemical energy is stored within the molecule ATP which is produced.

Oxidative phosphorylation follows; this is a process in which the NADH and FADH2 made in previous steps of respiration process give up electrons in the electron transport chain these are converted it to their previous forms, NADH+ and FAD. Electrons continue to move down the chain the energy they release is used in pumping protons out of the matrix of the mitochondria.

This forms a gradient where there is a differential in the number of protons on either side of the membrane the protons flow or re-enter the matrix through the enzyme ATP synthase, which makes the energy storage molecules of ATP from the reduction of ADP. At the end of the electron transport, three molecules of oxygen accept electrons and protons to form molecules of water...

Glycolysis: occurs in the cytoplasm. 2 molecules of ATP are used to cleave glucose into 2 pyruvates, 4 ATP and 2 electron carrying NADH molecules. (2 ATP are utilized for a net ATP of 2)

The Citric acid or Kreb's cycle: in the mitochondrial matrix- 6 molecules of CO2 are produced by combining oxygen and the carbon within pyruvate, 2 ATP oxygen molecules, 8 NADH and 2 FADH2.
The electron transport chain, ETC: in the inner mitochondrial membrane, 34 ATP, electrons combine with H+ split from 10 NADH, 4 FADH2, renewing the number of electron acceptors and 3 oxygen; this forms 6 H2O, 10 NAD+, 4 FAD.

Learn more about cellular life at brainly.com/question/11259903

Learn more about cellular respiration at brainly.com/question/11203046

#LearnWithBrainly

7 0

3 years ago