1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alina [70]
2 years ago
9

If a fruit fly develops legs on its head instead of antenna, what is the most likely reason?

Biology
1 answer:
goldenfox [79]2 years ago
6 0

Answer:

Chromosomal non‐non disjunction resulting in extra sets of genes

You might be interested in
In the arctic energy pyramid, which trophic level has the least amount of energy available to it? question 1 options: producers
Katena32 [7]
Producers have less energy available to them. They have to harness the light to produce energy. Their movement is restricted as a result. Tertiary consumers has the highest amount of energy at their disposal.
5 0
3 years ago
Read 2 more answers
What process is being used to break down macromoleucles? What happenes to the water during that process?
loris [4]
The process which is the breaking down of macromolecules is called Hydrolysis (the breaking of a bond in a molecule using water) This means that polymers are broken down into monomers. This literally means ‘Split water’ and a reaction between an ion and the water molecule is used during used during the breakdown.
5 0
2 years ago
Another name for cell division is the
djverab [1.8K]
M phase, or mitosis. 

(You don't need to know this for your course but more properly cell division could also refer to meiosis or binary fission.)
5 0
3 years ago
Read 2 more answers
Which kingdom does a multicellular living organism most likely belong to?
RideAnS [48]

Answer:

Eukarya - (D)

Explanation:

Organisms belonging to the plant kingdom are eukaryotic and multicellular organisms. They have a distinct cell wall made of cellulose. Cells are organised into true plant tissues. Plants contain plastids and photosynthetic pigments such as chlorophyll.

7 0
2 years ago
A species is a group of similar organisms that
Pavel [41]

Answer:  <u>can be with one another to produce fertile offspring. </u>

Explanation: Individuals of the same species can reproduce to make more individuals of the same species.

8 0
3 years ago
Other questions:
  • Do plants, like animals have trade that increase their productive​
    12·2 answers
  • What is the enlargement of an organ or tissue because of an abnormal increase in the number of cells?
    10·2 answers
  • Why do scientists use a light year to measure distances in space?Do you think there is a better way to measure distance? Explain
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Where does the exchange of materials in and out of a cell take place?
    12·2 answers
  • PLeAse PLeAse HeLp <br><br> Describe what happens when cells divide uncontrollably?
    5·1 answer
  • 13. Explain why some mutations are more harmful than others.
    10·1 answer
  • I can't stop farting.​
    11·2 answers
  • Which is the best explanation for where different types if minerals are found in earth
    5·1 answer
  • SITUATION: Teddy wants to prove if gravity really acts on each object. He used a paper and crumpled paper. He threw it at same t
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!