The assisted transport of a molecule through the cell membrane in deprived of expenditure of energy is facilitated transport. It transports molecules via specific trans membrane integral proteins because of being passive the facilitated transport does not directly require chemical energy from ATP hydrolysis in the conveyance step itself but rather molecules and ions move down their concentration gradient.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Answer:
Metaphase
Chromosomes line up at the metaphase plate, under tension from the mitotic spindle
Id search it up if i were you
Feedback occurs when outputs of a system are routed back as inputs as part of a chain of cause-and-effect that forms a circuit or loop. The system can then be said to feed back into itself
