1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ipn [44]
3 years ago
6

A common theory for the origin of the

Biology
1 answer:
Sergeeva-Olga [200]3 years ago
8 0

Answer:

yes.

Explanation:

because the figure represents a lot more similarities than differences

You might be interested in
Which are the basic units of a DNA nucleotide?
ohaa [14]

Answer:

The basic repeating unit of nucleic acids are known as nucleotides. A nucleotide consists of three distinct chemical groups, a 5-carbon sugar (ribose or deoxyribose), a nitrogen-rich base - (cytosine (C), guanine (G), adenine (A), thymine (T) in DNA or uracil (U) instead of T (in RNA), and phosphate.

8 0
3 years ago
Read 2 more answers
Which situation results from increased biodiversity in an ecosystem
Nastasia [14]

The correct answer is - increased competition.

If an ecosystem experiences an increase in its biodiversity, than the result of it would be increased competition. The increased competition will be for food sources, water sources, territory. The reason why increased competition will occur is that there are only limited mounts of food sources, water sources, and territory in the ecosystem. There's also certain amount of niches in the ecosystem, and once all of them are occupied by some species, any other that is specialized for that niche will be competitor plus. This increased competition will lead to high evolutionary pressure, which will result in relatively quick adaptations and specialization in order to survive.

3 0
3 years ago
Read 2 more answers
How does the need for resources affect the relationships organisms in an ecosystem?
Anarel [89]

Answer:

The need for resources will make the organisms competitive in their ecosystems.

3 0
3 years ago
The Clean Water Act:
Klio2033 [76]

Answer:

the answer is all of the above

4 0
2 years ago
Peptide bonds between amino acids formed primarily on the cells
harkovskaia [24]
They are formed primarily on the cell's Ribosomes. 
4 0
3 years ago
Other questions:
  • Proteins that provide nine essential amino acids are called:
    14·2 answers
  • Which is a vascular tissue in plants?<br><br> A) Fungi<br> B) leaves<br> C) phloem<br> D) roots
    11·2 answers
  • Which part of a cell directs the work of the cell
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The organization of the termite colony is an example of which benefit of social behavior?
    15·2 answers
  • What is the mean arterial pressure if some has for 150/90 blood pressure
    10·1 answer
  • Help me pls i will mark you as brainliest
    12·2 answers
  • Plant roots can prevent erosion<br> True or False
    8·2 answers
  • How did the drought most likely affect populations of grasshoppers living in the grassland ecosystems? Choose the correct answer
    11·1 answer
  • I'm to smoll brain for dis
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!