1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Likurg_2 [28]
2 years ago
12

What are these monomers

Biology
1 answer:
Sidana [21]2 years ago
4 0

Answer:

Съжалявам не знам

Explanation:

благодаря за точките,

You might be interested in
Choose all the answers that apply. Ground tissue _____.
7nadin3 [17]

Answer:

<em>supports the plant</em>

<em>makes up the majority of a plant</em>

3 0
3 years ago
Can someone help me with this please? Match the following organelle to its function.
kap26 [50]

Answer:

lysosomes

endoplasmic reticulum

vacuoles

mitochondria

cytoplasm

golgi apparatus

ribosomes

chloroplast

Explanation:

in order of the functions listed

4 0
1 year ago
The state of maintaining a stable internal environment regardless of changing external conditions is called
Alex787 [66]

The state of maintaining a stable internal environment regardless of changing external conditions is called \sf\purple{homeostasis}.

\bold{ \green{ \star{ \orange{Mystique35}}}}⋆

5 0
3 years ago
Plz help me <br> WILL GIVE BRAINIEST
Illusion [34]

Answer:

The correct answer to this question should be a drup called antibiotics.

In our case, we need to look for something that helps us deal with bacteria infection, or in other words, treating diseases caused by bacteria. A drup that interfers with viral DNA is responsible for treating a kind of virus that basically  attack DNA to live. And I would consider the drug that moderates you use of sugar should be used to solve problem related to the amount of sugar in your body, maybe diabetes. Antibiotics is especially designed to kill bacteria, so it is the correct answer.

7 0
3 years ago
Stromatolites are rocky structures that generally form in shallow waters from the binding of sediment by microbial biofilms. Str
hjlf

<u>Answer:</u>

Approximately, the oldest stromatolites are 3.6 billion years old on earth.

<u>Explanation:</u>

  • Stromatolites is not only oldest earths fossil but conspiracy in that they are singular visual portal in deep time on earth.
  • It is defined as laminated accumulation structure that is they stick up above sea floor .
  • Stromatolite buildings includes oldest fossils which are 3.5 billions old when the earth were too unfriendly to support life.
  • The study of  fossil age, evolutionary, method of formation are known as paleontology.
  • These specimens are considered as old fossils which are around 3.4 to 4.1 billions years old.
7 0
3 years ago
Other questions:
  • What is the cell nucleus?
    6·1 answer
  • Which of the following characteristics is typical of the lytic cycle of a bacteriophage? A) Viral DNA is incorporated into the h
    14·1 answer
  • Ecology - Describe how environmental changes may produce behavioral, physiological, morphological, or adaptive responses in orga
    10·1 answer
  • An atom has at least one positive proton and at least one negative electron. Which of the following is true about the protons an
    8·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which best explains why water is able to “stick” to the side of glass? Strong adhesive forces exist between different water mole
    10·1 answer
  • Where does respiration take place?​
    14·1 answer
  • Which of the following do most
    6·2 answers
  • What will most likely happen if the human population continues to grow and carelessly emit gases?
    13·1 answer
  • Characterization of the leptospiral outer membrane and description of three novel leptospiral membrane proteins
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!