1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
avanturin [10]
3 years ago
7

How can the smallest unit of matter (the atom) contribute to the structure of living things?

Biology
1 answer:
Marysya12 [62]3 years ago
6 0

Answer:

when two or more atoms combined together they make molecule and two or more molecule make substance and when they combined uncounted then they make the living thing hope ur help and mark me brainlist

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Type of neuron that receives messages from the environment
aleksklad [387]
Type of neuron that receives messages from the environment is a sensory neuron ie it receives messages from the 5 senses which are used by man to investigate the environment.
8 0
3 years ago
Which statements about mutations are true? Check all that apply.
Gekata [30.6K]

Answer:

most forms of cancer are caused by somatic mutations

Explanation:

5 0
3 years ago
Dissolving salt into water is an example of ____________________.
Zepler [3.9K]

Answer:

B.

Explanation:

3 0
3 years ago
The site of DNA replication is called
nexus9112 [7]
The leading strand is the strand of nascent DNA which is being synthesized in the same direction as the growing replication fork. A polymerase "reads" the leading strand template and adds complementary nucleotides to the nascent leading strand on a continuous basis.
3 0
4 years ago
Read 2 more answers
Other questions:
  • Many crops such as tomatoes and corn are now routinely genetically manipulated to become more resistant to disease and herbicide
    12·2 answers
  • The human genome contains approximately 20,000 protein-coding genes, yet it has the capacity to produce several hundred thousand
    12·1 answer
  • Which substance can enter a cell by diffusion without having to be digested
    14·1 answer
  • URGENT!!!!!!!!!!!!!!       What occurs when a trait is linked to the x-chromosome and is passed on by one or both parents?
    14·1 answer
  • Homologous pairs of chromosomes are lined up independently of other such pairs during _____. prophase II telophase II metaphase
    8·1 answer
  • The study of the earth's atmosphere and the processes that produce weather and climate conditions
    7·1 answer
  • Cell ______ is the process during which cells become progressively restricted in their developmental potential.
    6·2 answers
  • True or false please be experienced and know what you are doing. If you are not good at life science please skip this question.
    7·1 answer
  • Transcribe the following DNA sequence into mRNA: ATT ATG GAC CCG
    8·1 answer
  • Milk is produced in microscopic sacs called _______ and travels down _______ to the nipple. group of answer choices
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!