1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tangare [24]
3 years ago
15

Oxygen is a survival need. Why is it so important?

Biology
2 answers:
d1i1m1o1n [39]3 years ago
6 0

Answer:

oxygen

Explanation:

oxygen is an essential nutrient which the body needs especially during respiration.

it help the blood cells do provide energy.

without oxygen, there is no gaseous exchange

lesya692 [45]3 years ago
6 0

Answer:

Because it's the only gas that can support life and without it o no human or animal can survive

You might be interested in
Which determines carrying capacity
ivann1987 [24]
Is there examples or choices to choose from?
5 0
3 years ago
Read 2 more answers
Which of these are a ring shaped lipid?
Troyanec [42]

Answer:Steroids like cholesterol are lipids and have a ring structure

Explanation:

6 0
3 years ago
Read 2 more answers
Igneous rocks can be formed from magma that solidifies deep beneath the earth's surface. When it cools quickly, it creates more
ikadub [295]

the answer above is B!

8 0
3 years ago
Read 2 more answers
What is pcr based genetic test?
Makovka662 [10]
It is polymerase chain reaction hope this helps
4 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Other questions:
  • Sometimes a suffix functions independently as a medical term. give two examples of suffixes that are also terms, and explain how
    13·1 answer
  • Can someone please help me?
    12·1 answer
  • Please helppooppp its 100 points
    6·2 answers
  • Which organism will have DNA most similar to the bird? Why?
    10·1 answer
  • which part of the central nervous system is used to serve as the main communication link between the body and the brain
    10·1 answer
  • Sexual reproduction can be divided into two different types based on which of the following?
    8·1 answer
  • The heart is a <br> that pumps blood and other materials through the body.
    14·1 answer
  • 1. A phenotype is an inherited feature that varies from individual to individual. 2. A is one particular variation of a characte
    8·1 answer
  • Line t passes through (4, 5) and is perpendicular to the line shown on the coordinate grid.
    9·1 answer
  • How do convection currents in the atmosphere form?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!