1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tangare [24]
2 years ago
15

Oxygen is a survival need. Why is it so important?

Biology
2 answers:
d1i1m1o1n [39]2 years ago
6 0

Answer:

oxygen

Explanation:

oxygen is an essential nutrient which the body needs especially during respiration.

it help the blood cells do provide energy.

without oxygen, there is no gaseous exchange

lesya692 [45]2 years ago
6 0

Answer:

Because it's the only gas that can support life and without it o no human or animal can survive

You might be interested in
A group of organs that work together to perform specific activities for an organism
Mkey [24]
Organ system is the answer according to me if it is one word question
6 0
3 years ago
Read 2 more answers
Which of the following is a function of the nervous system?
N76 [4]
I think the answer is C. increasing cellular respiration in muscle tissues 
hope i can help ✨
7 0
3 years ago
How many hydrogen atoms are in a molecule of water?
USPshnik [31]
There are two hydrogen atoms in a molecule of water.
8 0
3 years ago
Read 2 more answers
Which type of asexual reproduction involves duplication of the parent DNA before dividing itself into two?
Kipish [7]

Answer:

binary fission - asexual reproduction by a separation of the body into two new bodies. In the process of binary fission, an organism duplicates its genetic material, or deoxyribonucleic acid (DNA), and then divides into two parts (cytokinesis), with each new organism receiving one copy of DNA.

7 0
2 years ago
Does photosynthesis by plants remove CO2 from the
Andreas93 [3]

Answer:

carbon dioxide is released during leaf respiration (intake of oxygen), but it is quickly reabsorbed during photosynthesis.

Explanation:

8 0
2 years ago
Other questions:
  • Name any four materials that we should avoid using to save our environment and why?
    5·2 answers
  • Which of the following reasons explains why if salt water is heated, the water turns into steam while the salt remains?
    7·2 answers
  • I am shiny. I form +1 ions. There's more!
    10·2 answers
  • “Scientists have estimated that about 95 percent of all the cells in the body are bacteria.” Based on the quote, what role does
    8·1 answer
  • With the global population constantly increasing, at some point food will become limited. What is a way that should NOT be used
    7·1 answer
  • The free energy for the oxidation of glucose to CO2 and water is -686 kcal/mol, and the free energy for the reduction of NAD to
    14·1 answer
  • What do index fossils tell scientists about the area? ​
    5·2 answers
  • Euglenoids are freshwater protists that are both photosynthetic and
    11·1 answer
  • The lifecycle of a flowering plant starts again when a mature plant produce what?
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!