1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
posledela
2 years ago
11

Which is NOT true about cells?

Biology
1 answer:
Andrei [34K]2 years ago
8 0

Answer:

B is the answer of this question

You might be interested in
Animals release what into the atmosphere through what
Flauer [41]

Animals release carbon dioxide (CO2) into the atmosphere through the process of respiration.

5 0
3 years ago
What mistake does the man make in building the second fire? Apex
Vlad1618 [11]

<u>Answer</u>:-

It is option c:

“He build sit underneath a tree”.

Explanation:

The second fire goes out because the man makes a mistake:

He builds the fire under a Pine tree. Although this makes it easier for him to collect sticks to feed the flames, it ultimately proves fatal. Eventually, the snow falls onto the fire itself, extinguishing it and leaving in its place a pile of fresh ❄️ snow.

5 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
The ribosome is called the ____________ ; because it can read mRNA language &amp; turn it into amino acid language.
Scrat [10]

Answer:

DNA Translator

Explanation:

The ribosome is called the DNA TRANSLATOR; because it can read mRNA language & turn it into amino acid language.

This amino acid chain is known as polypeptide

6 0
2 years ago
Why is everyone pretending Mrs. Dodds didn't exist?
frosja888 [35]

Answer:

It was a prank

Explanation:

everyone decided to prank percy and act like mrs dodds didnt exist

7 0
3 years ago
Other questions:
  • Which diagram in figure 32-2 shows an example of a joint involved in lifting your arms above your head?
    6·1 answer
  • Which of these is a type of mass movement that is likely to happen after a large amount of rain?
    14·2 answers
  • Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is
    9·2 answers
  • How do plants respond their environment
    11·1 answer
  • Which of these BEST describes the difference between a hypothesis and a theory?
    6·2 answers
  • In mammals, blood returning from the head will pass through the ________ just before entering the right atrium.
    7·1 answer
  • The building block of DMA function in larger unites called:
    11·1 answer
  • Spring tides are the lowest tides of the year.<br> True<br> False
    8·1 answer
  • All Stars in a given star cluster form from the same nebula<br><br>True<br>False​
    13·1 answer
  • A compound in cranberries may prevent some bacteria from clinging to the urinary tract and help prevent urinary tract infections
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!