1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Georgia [21]
2 years ago
11

Can a hypothesis be proven true? Why or why not?

Biology
1 answer:
VladimirAG [237]2 years ago
5 0

Answer: Hello! xoxo

Upon analysis of the results, a hypothesis can be rejected or modified, but it can never be proven to be correct 100 percent of the time. For example, relativity has been tested many times, so it is generally accepted as true, but there could be an instance, which has not been encountered, where it is not true.

You might be interested in
Which sequence correctly indicates the branching pattern of the human respiratory system?
larisa86 [58]

Answer:

A

Explanation:

7 0
2 years ago
This table is dirty. near far plural singular
denis23 [38]

Answer: Singular

Hope this helps

Explanation:

8 0
2 years ago
20 POINTS
EleoNora [17]
<span>They are clones of the parent plant.!</span>
7 0
3 years ago
Read 2 more answers
IN FIVE TO TEN SENTENCES, DISCUSS the major concepts of populations, and
nekit [7.7K]

Answer:

A small change in our ecosystem could forever impact the whole web. For example, if bees were to go extinct, then flowers wouldn't be able to reproduce (since bees fertilize the flowers). Meaning the flowers would die out. And a lot of living things, including humans, depend on bees. Or let's say that a sharks were to go extinct. They play a major role in our ecosystem, because they eat fish and other sea creatures. The prey would then grow in population. Which would lead to a disaster. So in short terms, every creature in the ecosystem is vital to maintain the balance. I hope this helps!! :)

6 0
2 years ago
Which four body systems interact to allow a person to sneeze
kifflom [539]

Answer:

The sneeze centre sends signals to the parts of your body that need to work together to help you sneeze. Your chest muscles, diaphragm, abdominals, vocal cords and the muscles in the back of your throat all work together to help you expel the irritant. Muscular, immune, nervous, respiratory.

Explanation:

8 0
2 years ago
Other questions:
  • which of the following shows the correct order in which genes are expressed? a. DNA to rna to proteins. b. rna to DNA to protein
    12·2 answers
  • What happens to animals that are deprived of oxygen
    10·2 answers
  • What pattern of inheritance does this pedigree chart represent? (squares are male/circles are females
    14·1 answer
  • in a parent pea plant with the allele pair Gg, what is the probability they one gamete will contain the G allele? ...?
    12·1 answer
  • Which option identifies ways that people positively affect Earths resources
    7·1 answer
  • Which sentence describes how an animal might interact with the abiotic factors in its environment?
    9·2 answers
  • What are the reasons for the several day delay in a primary response. Infection______. A. transport to secondary lymphoid tissue
    9·1 answer
  • What does a sand shark look like?
    7·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • I'll give likes and thank yous and try to give brainiest! Which of the following organisms are capable of self feritlization?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!