1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
daser333 [38]
3 years ago
6

Please help!!

Biology
1 answer:
diamong [38]3 years ago
8 0

Answer:

Eutrophication is an excess of

<u>plants</u><u> </u><u>and algal growth</u><u> </u>often caused by run-off from lawns or

farms that wash excess fertilizer into rivers or coastal waters.

plant.

You might be interested in
Humans have altered the carbon cycle by
zloy xaker [14]

Answer:D) all of the above

Explanation:these are all correct because they all affect our environment

4 0
3 years ago
Read 2 more answers
1. Energy transfer is inefficient between trophic levels because
dangina [55]

Answer: b dead organisms And waste are recycled throughout the tropic levels.

Explanation:

5 0
3 years ago
Read 2 more answers
Bird guides once listed the myrtle warbler and Audubon's warbler as distinct species Recently, these birds have been reclassifie
ser-zykov [4K]

Answer:

The two forms interbreed and their offspring survive and reproduce well.

Explanation:

When talking about classification of species, one of the first features observed is the species fitness, which describes the reproductive success or their ability to leave to their successive generations the most copies of their genotype. When different species that were recently divided into 2, by geographic isolation, for instance, usually there is no genetic compatibility, and if its possible to produce offspring, there might be some development issues like infertility.

8 0
3 years ago
Which process occurs as a zygote divides to form a multicellular embryo?
Snezhnost [94]

Answer: meiosis

Explanation:

7 0
3 years ago
which of the following distinguished living things from nonliving things? A. living things are made up of cells nonliving things
katovenus [111]
<span>the answer is B. living things</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of leonardo's experiments ended disastrously?
    13·1 answer
  • The part of an atom that is mostly empty space is the
    9·2 answers
  • If the three-base combination of T-C-G within a gene was in the process of DNA synthesis, what would be the complimentary base
    11·1 answer
  • 3. How does someone feel during "isolation"
    15·2 answers
  • Which of the following do you expect if an individual is heterozygous for the sickle-cell trait?
    6·1 answer
  • Would you be likely to find a food chain containing 10 links? Why or why not?
    10·1 answer
  • A snail, elodea (aquatic plant), or both were added to the tubes and they were stoppered. Tubes were placed under a grow light f
    7·1 answer
  • 8.
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is Alternation of generation ?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!