1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ulleksa [173]
2 years ago
13

Please help, will give brainliest !!

Biology
1 answer:
Naddika [18.5K]2 years ago
6 0

Answer:

You answer is A

Explanation:

A combination of high salinity and low temperature near the surface makes seawater dense enough to sink into the deep ocean. Hopefully this help if it didnt my bad

You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Sally won the 200 m race in 39 seconds. How fast was she going?
grigory [225]

speed = distance/ time

Sally's speed = 200m / 39 s = 5.13 ms^-1

8 0
2 years ago
Earth’s continents are constantly in motion because they sit on top of gigantic plates which float on Earth’s mantle. Energy fro
Andrej [43]

Answer:

a. biomes

Explanation:

Ecology can be defined as the scientific study of the relationship between living organisms such as plants and animals in relation to their physical and biological environment.

An ecosystem can be defined as the natural living habitats of both living and non-living organisms, in which they interact with one another. Essential services such as plant pollination, water purification, nutrient cycling etc that are being provided by the ecosystem are really very vital, important and useful for the sustenance of life, both for humans and enhances social welfare.

Generally, the different continents on Earth are in a constant motion due to the fact that they're sitted on top of gigantic plates floating on Earth’s mantle.

Furthermore, the Earth’s core generate energy which also creates convection currents in the molten layer of the Earth, thereby, moving the plates.

Over an extremely long periods of time, the movement of these plates create new biomes.

In Ecology, a biome can be defined as a relatively distinct terrestrial region which is made up of animals, micrograms and plants, and it is typically characterized by similar environmental factors such as wind, relative humidity, rainfall, temperature, etc., irrespective (regardless) of where it occurs in the world.

There are five (5) main types of biomes and these are;

I. Forest.

II. Aquatic.

III. Desert.

IV. Grassland.

V. Tundra.

7 0
2 years ago
Animal stomachs have enzymes that break down food into smaller components. Enymes do this by.... (a) increasing stomach acids (b
jolli1 [7]
I think the answer is A
5 0
3 years ago
An experiment is designed so that you can observe the differences between the experimental group and the ?
eduard
Good evening Aixa,

An experiment is designed so that you can observe the differences between the experimental group and the control group.

The experimental group is the group of specimens you're exposing to the experiment and the control group is a separate group of specimens that is not being exposed to the experiment, but are also being observed.

-Hope this helps!

6 0
2 years ago
Other questions:
  • Researchers studying microbial activity at another active oil-spill site found decreasing levels of methane over the course of s
    15·1 answer
  • What instrument was essential to the development of the cell theory?
    7·2 answers
  • What moves across axons?
    8·2 answers
  • Which sequence correctly traces the path of a protein in the cell?
    13·2 answers
  • Why is the SI measurement system so important to the scientific community
    7·1 answer
  • The peripheral nervous system is to sensory neurons as the central nervous system is to
    5·1 answer
  • Which of the following is one factor in the type of eruption that occurs?
    13·1 answer
  • _______________________ is the process of cell modification from a generalized cell to one that performs a specific task.
    11·1 answer
  • What do the following two equations represent?<br> 5x +y = 3<br> . 10x + 2y = -6
    15·1 answer
  • What alternative form of genes do nucleic acids have that allows them to offer variability?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!