Answer:
Cristal is formed when the solution is cooling because the solvent can't keep all the molecules of the substance and these molecules are beginning to leave the solvent and form solid crystals.
Explanation:
It means that every crystal is formed of one molecule of the solvent. When the solvent reaches room temperature, it is moved to the ice bath to finish the process of crystallization.
What are the answer choices?
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: