1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erik [133]
3 years ago
14

This leads to other question. You have observed that older pennies

Biology
1 answer:
blondinia [14]3 years ago
3 0

Answer:

sorry i don't know this question answered

You might be interested in
10 points a question please answer all 3
AlladinOne [14]
W33d is the answer duh as always
3 0
3 years ago
To supply the developing fetus with the calcium required for teeth and bones, pregnant women should:
Jet001 [13]

Continue to consume the calcium recommended for non-pregnant women because calcium absorption increases during pregnancy which will provide for the fetus. The good news is that most women do not experience bone problems during pregnancy and breastfeeding.  For the good health of both the mother and her baby she should take care of one’s bone health is especially need during pregnancy and breastfeeding, 

4 0
3 years ago
The “brain” of the cell is located in the
mariarad [96]
The Nucleus is sort of like the "brain" of a cell.
4 0
3 years ago
Read 2 more answers
Which letter correctly identifies telophase 1
TiliK225 [7]
It would be G and H because that is when the nuclear membrane forms and two new cells are formed

hope this helped :3
3 0
3 years ago
Which of following is a use for fossils found in sedimentary rocks?
Greeley [361]

Answer:

i am pretty sure it would be B. All the above... not positive though

Explanation:

tell if wrong.... have a nice day!

7 0
3 years ago
Other questions:
  • If Tyler does not eat a diet that excludes essential amino acids , his cells will not be able to build
    9·1 answer
  • Woese introduced a new method of classifying life on Earth when he introduced the _________, defined as a taxon higher than the
    8·1 answer
  • I need help on this question
    8·2 answers
  • What must cells take in in order for cellular respiration to take place?
    5·2 answers
  • A student drew the following flowchart.
    15·2 answers
  • How has our relationship with milk changed pollution in the last 200 year
    5·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Help, please! I will give brainliest!!
    9·1 answer
  • Solutes are sometimes measured in milliosmoles. Explain the statement, 'Water chases milliosmoles."
    11·1 answer
  • READ CAREFULLY!!! THE OTHER ANSWERS ON BRAILY ARE NOT THE SAME AS THESE Which of the following would be most likely to cause a m
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!