1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Salsk061 [2.6K]
2 years ago
10

7.

Biology
1 answer:
yulyashka [42]2 years ago
6 0

Answer:

27.5

Explanation:

Divide 75 by 6. You get 12.5. Multiply 12.5 by 2.2 (when converting kilo to pound, you multiply by 2.2) Then, you'll get 27.5. The answer is 27.5 pounds/lbs.

You might be interested in
Explain which of the two plants in the following scenario would most likely grow taller, and why.
xenn [34]

Answer:

The oak tree in the lawn will grow faster because it doesn't have to compete with the other oak trees to gain sunlight because it is out in the open. So therefore it will grow taller because it has access to more sunlight.

Explanation:

Hope this helped

5 0
3 years ago
The table below gives the speed of an object every minute from 9:00 am to 9:06 am.
gogolik [260]

Answer: A

Explanation:

4 0
2 years ago
Explain why some species are able to tolerate polyploidy and others can not. You may provide specific examples to support your a
lidiya [134]
<h2>Tolerate Polyploidy</h2>

Explanation:

  • Various species display various degrees of resilience for polyploidy. For instance,<em> polyploids structure </em>at moderately high recurrence in <em>blossoming plants (1 for every 100,000 people)</em>, recommending that plants have a strikingly high <em>resistance for polyploidy.</em> This is likewise the situation for certain types of fish and frogs.  
  • Polyploidy is normal in plants than in creatures in light of the fact that in creatures sex assurance component includes <em>number and type sex chromosomes. </em>
  • Polyploidy will meddle with this component and subsequently it is seen once in a while in animals.This vegetative proliferation empowers increase of <em>polyploid plants.  </em>
  • Chromosomes can be divided by  by their such as <em>size,banding design number, centromere position. </em>
  • <em>Autosomes or "body chromosomes"</em> (the entirety of the non–sex chromosomes) are commonly found in the human karyotype sorted out in rough request of size from biggest (chromosome 1) to littlest (chromosome 22).  
  • The number and presence of chromosomes in a phone is known as a karyotype.
  • A karyotype must be seen and examined with a magnifying lens. Karyotype investigation can uncover anomalies, for example, <em>missing chromosomes, additional chromosomes, erasures, duplications, and translocations.</em>
5 0
3 years ago
In the formation of baby boy or baby girl, mother does not have the main role. why?​
svp [43]
A child's gender (male or female) is determined by the chromosome that the male parent contributes.

Females have XX sex chromosomes.

Males have XY sex chromosomes.

A male infant results if the male contributes his Y chromosome while a female infant results if he contributes his X chromosome.
6 0
3 years ago
When is the lac operon most active?
Vera_Pavlovna [14]

Answer: The correct answer to the question is option WHEN GLUCOSE LEVELS ARE LOW AND LACTOSE IS PRESENT.

Explanation: To start with,Lac operon can be simply defined as a part of the DNA that is under the part of the DNA is manipulated and controlled by the same promoter,they can be found in some prokaryotic cells giving room for regulation over excess synthesis of protein.so simply put,these specific segment of the DNA binds with the segment of the polymerase of RNA so that transcription of the mRNA from the operon genes will be achieved.

Lac operon is also known as lactose operon, it is seen in some enteric bacteria like e.coli where they play a crucial role in coding of genes for those proteins that function in moving lactose into the cystocel and digesting it to form glucose that is used for energy generation. These lac operon are are most active when glucose levels are low and lactose is present,with the low level of glucose, the lac operon can be transcribed to a high level,this is to ascertain that the bacteria only gets to activate the lac operon and can only make use of it,that is using lactose when all the preferred energy source from glucose has been exhausted.

6 0
2 years ago
Other questions:
  • What is true of marriage in India
    7·1 answer
  • Which of these is an example of a chemical change?
    8·2 answers
  • What statement would least likely be used to describe variation
    12·2 answers
  • Select all that apply.:Which structures are found in plant cells?. . A. central vacuole. . B. cell wall. . C. cilia. . D. chloro
    6·1 answer
  • For a protein to be an integral membrane protein it would have to be
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Fats that contain ____ double bonds are liquids at room temperature, whereas fats that contain ____ double bonds are solids at r
    6·1 answer
  • Match the muscle with the correct<br> letter from the diagram.
    7·1 answer
  • Help me please I don’t understand what to do here.
    15·1 answer
  • You are researching a population of moles. In the course of your research, you identify a nearby population that occasionally co
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!