1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
2 years ago
11

What is an agro-forestry?

Biology
1 answer:
Sliva [168]2 years ago
7 0

Answer:

Agroforestry is a collective name for land-use systems and technologies where woody perennials (trees, shrubs, palms, bamboos, etc.) are deliberately used on the same land-management units as agricultural crops and/or animals, in some form of spatial arrangement or temporal sequence.

You might be interested in
What kind of molecule is shown in the diagram below?
Leona [35]

Answer: Lipid for Apex

5 0
3 years ago
Read 2 more answers
PLEASE HELP!! BIOLOGY
GaryK [48]
C) the changes reflect...
8 0
3 years ago
Read 2 more answers
Which sum stance is a product of photosynthesis
kogti [31]

Answer:

A product of photosynthesis is glucose wich is sugar.

8 0
3 years ago
Read 2 more answers
What do the endoplasmic reticulum and Golgi body have in common?
Alina [70]
B the golgi body and rough/smooth endoplasmic reticulum are able to synthesise vesicles the only difference is that one synthesises vesicles that go from one organelle to another where as the other synthesises vesicles that travel to the outside of the cell.
8 0
3 years ago
Select all that apply
trapecia [35]
I know that for sure it's in the workplace and I think hospital or clinic
6 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following genotypes indicates a homozygous dominant trait?
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What takes place during transcription?
    6·1 answer
  • Which cross will yield four phenotypes in the 1:1:1:1 ratio?. .A] rryy x rryy. B] RrYy x rryy. C] RrYy x RrYy. D] RRYY x rryy
    5·1 answer
  • What is the effect of large populations of deer on ecosystems?​
    5·1 answer
  • The nurse reviews discharge instructions with a client who has advanced chronic obstructive pulmonary disease. Which client stat
    9·1 answer
  • Which cell structure functions as a storage site for water
    12·1 answer
  • What are the products of the light-dependent reactions?
    6·1 answer
  • The smaller units or 'buildings blocks' of which proteins are made​
    9·1 answer
  • How can pollution travel from one resource to another? Complete the table by describing one example for each set of resources.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!