1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brums [2.3K]
2 years ago
15

Sign an experiment.

Biology
1 answer:
expeople1 [14]2 years ago
5 0

The answers to the questions required for the design experiment above are :

  • If shark attack are related to the number of elephant seals in an area, then shark attack will increase as the number of elephant seal increases

  • If shark attack are unrelated to number of elephant seal in an area, then shark attack is unaffected by increase or decrease in number of elephant seal.

  • The Control Group : Beaches or areas where elephant seals aren't present or period of the year when there are no elephant seal at the beach.

  • The Experimental group : Beaches where varibale portions of elephant seals are found (area with high, medium or low).

  • The Dependent variable : Number of shark attacks

  • The Independent variable : The different number of elephant seals found.

  • Data to be collected include : The number and type of elephant seals found at various beaches and the number of shark attacks recorded at the various points.

  • John will be able to deduce if the number of elephant seals and number of shark attacks recorded corded are related.

The hypothesis of an experiment is a proposition which requires experimental testing in other to establish it's validity.

The Control Group refers to a portion of the subject which aren't given or exposed to the treatment used in an experiment.

The Experimental group are the portion of the subjects which are subjected to the treatment condition.

The Dependent variable is the measured variable is changes as the independent variables are tweaked.

Independent variable is the predictor variable, it causes a change in the output of the dependent variable.

Learn more : brainly.com/question/17528320?referrer=searchResults

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
Avery and DNA (page 289)
Ivan

Yes, Avery, Mc Leod and Mc Carty do thought that genes may be involved in the transformation of non virulent rough Strains of <em>Diplococcus pneumoniae</em> to harmful smooth strained bacteria

<h3><u>Explanation:</u></h3>

Avery was a Canadian medical researcher who along with other two well known scientists of the contemporary time went for an experiment where he took two strains of bacteria Diplococcus pneumoniae - one is rough and nonvirulent and another is smooth and virulent. For a control run, he injected both the bacteria in separate mice and the expected result was there. Now as he injected heat killed smooth bacteria, the mice survived. But as he injected heat killed smooth bacteria with rough bacteria, although there was no organism which can kill the mice the mice died. And autopsy revealed the presence of live smooth bacteria in the lungs.

Thus they suspected something have gone from the dead smooth bacteria into the non virulent rough bacteria which lead to transformation of the rough bacteria to smooth ones. Thus, the experiment was carried on, which suspected role of genes in this transformation.

5 0
3 years ago
Could someone help me with this because , i like dont understand at all.
adoni [48]

Answer:

1. Busted

2. Confirmed

3. Busted

4. Confirmed

7 0
3 years ago
Read 2 more answers
In a study on the biological bases of learning, lab rat a is given a drug that blocks dopamine activity in its brain. thereafter
Anvisha [2.4K]
We should expect that the rat will have have more difficulty in learning the task compared to a normal rat. This is because the rat has been injected with a certain drug that oppresses the dopamine activity. And then the rat is placed in an operant chamber where a lever-pressing task is shaped through positive reinforcement. 
8 0
2 years ago
HELP ME!!! BIOLOGY!!!!
spin [16.1K]

Answer:

1. water, CO2 and Light energy

2. the runner's cells are making up for an oxygen deficit

3. chloroplasts absorb sunlight

4. carbon dioxide

5. eukaryotes

Explanation:

6 0
3 years ago
Other questions:
  • Which of the following shows the change in energy carrying molecules as a system
    5·2 answers
  • What’s a good definition for weather
    15·1 answer
  • In gorillas, the ability to roll the tongue is under the control of 1 gene. The R allele, which confers tongue-rolling ability,
    11·1 answer
  • What is the main function of albumin?
    12·1 answer
  • Can someone please help?
    12·1 answer
  • The distinct role a species plays in its ecosystem.
    8·1 answer
  • What is succession and what are the steps to succession? Why is it important?
    15·1 answer
  • Please help I don't understand ​
    11·2 answers
  • Where do the fruits and seed of the mango come from?​
    15·1 answer
  • HELP ASAP. WILL GIVE BRAINLIEST!!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!