1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
2 years ago
7

What is it called if something travels a greater distance in a shorter amount of time ANSWER FAST

Biology
1 answer:
Inga [223]2 years ago
6 0
Isn’t that the blood??
You might be interested in
Which breed of dog is most likely to be trained as a
Verdich [7]

Answer:

I would say an australian shephard

Explanation:

8 0
3 years ago
Read 2 more answers
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
2 years ago
Selects asample of n= 20 pregnant rats and mixes alcoholwith their food for 2 weeks before the pups are born.one newborn pup is
Dafna11 [192]

Your answer would be:

n = 20 pups is recorded.

known that the average birthweight for regular rats (without exposure to alcohol) is μ = 5.6 grams.

sample of n= 20 pregnant rats and mixes alcohol with their food for 2 weeks before the pups are born.

One Newborn pup randomly selected from each litter.

A.). What type of test you would use, to test the hypothesis that, alcohol consumption during pregnancy reduces birth weights? Answer, There is one treatment group, pups of alcohol-fed rats, which is being compared to a known population of regular rats, so the most appropriate statistical test is the z-test.

B.). Would you use a one - tailed, or two - tailed test? Answer, The independent variable is the alcohol condition whether, or not, / the pup’s mother received alcohol while pregnant; The dependent variable is the birth weight

C.). What would be an appropriate measure of effective, size to report?Answer, The scale of measurement for the independent variable is nominal. The scale of the dependent variable (birth weight) is ratio; effective size would be measured by Cohen's d, or r2.

Hope that helps!!!! : ) Answer: zx, Because, there is only one sample; and, it is compared to all the previous patients,/population. The σ, is given.

6 0
3 years ago
Taxonomic classification involves sorting a given organism into progressively more specific levels of categories until you find
Novay_Z [31]

Answer:

Kingdom --> phylum/division --> class --> order --> family --> genus --> species

Explanation:

The formal system of classification used in taxonomy was introduced by a Swiss scientist named Carolus Linnaeus.

He first split living things into a general category called KINGDOM.

- The kingdom is further split into large smaller groups called PHYLUM (for animals) and DIVISION (for plants).

- Each phylum or division is broken down into CLASSES.

- Each class is broken down into ORDERS

- Orders into FAMILIES,

- Families into GENUS

- Genus into SPECIES

Thus, the system of classification from highest (most general category) to the lowest level is as follows: Kingdom --> phylum/division --> class --> order --> family --> genus --> species

7 0
3 years ago
"Which molecule controls the rate of pentose phosphate pathway?
kirza4 [7]

Answer:

Part 1:

Correct option is A: "NaDP+/NaDPH"

Part 2:

Correct option is F: "glucose 6-phosphate dehydrogenase"

Explanation:

Various levels of control are put in place to keep a check on the pathway. This is an example of one such control. This dehydrogenase enzyme is responsible to control the rate of reaction and it is stimulated by NADP+ while it is inhibited by NaDPH. The oxidative reaction is under the influence of the NaDP+/NaDPH concentration, which is catalyzed by glucose 6-phosphate dehydrogenase.

Hope that answers the question, have a great day!

5 0
3 years ago
Other questions:
  • Which statement about vacuoles is true
    14·1 answer
  • If you want to improve your muscular endurance, what is the best plan?
    14·2 answers
  • Cyanobacteria have been engineered to produce isobutanol directly. What advantage does this have over other alternative biofuels
    7·1 answer
  • What are the different organelles that make up our cells
    5·1 answer
  • A gland secretes enzymes through a duct onto the surface of a body part. Which gland is it most likely to be?. . A.pituitary gla
    7·2 answers
  • you notice a sign in a parking structure that says "Warning: This area contains chemicals known to the state of California to ca
    6·2 answers
  • A gene is composed of two alleles. An allele can be either dominant or recessive. Suppose that a husband and​ wife, who are both
    7·1 answer
  • The interactions between the red blood cell and important molecules, cells, and organs
    13·2 answers
  • Which of the following terms would Bb
    8·1 answer
  • Water vapor present in air support water cycle <br>​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!