1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leno4ka [110]
3 years ago
14

If the rain falls in many of the places where people do not live, how does it yet to

Biology
1 answer:
Kisachek [45]3 years ago
3 0

e9edooekeejjdjdjdjdjjdjd

You might be interested in
Which of the following is an example of the current impact DNA technology has on human health?
Xelga [282]

Answer:plants grow

Explanation:te she said so

8 0
3 years ago
What is this? Please answer with an explanation and if you get this right I'll give you a like and a 5 star
LekaFEV [45]

Answer:

its C

Explanation:

i do AP bio so this is something learned a long time ago also im a straight A student so yeah

4 0
3 years ago
What is likely to happen if an animal species grows larger than the carrying
lara31 [8.8K]
B. Because the environment can not supply for the food and caring of the animal species that is growing larger.
5 0
3 years ago
Help please answer fast!!!
Murljashka [212]

Answer:

A graph not only depends on the data that we are graphing, there are other important factors such as the units we use (here we have °C vs years, but we could have °F vs days and we would see a different graph, which represents the exact same information) , the scale we use (a lot of graphs are misleading because of the use of logarithmic scales, we need to be clear about the scales we use), where we put the zero of each axis (We usually use the intersection of both axes as the (0, 0) point, but this is not a necessary condition, we could manipulate our coordinate axis as we want) , etc.

So there are a lot of things that can impact on how we see the graph of the same data.

About the second answer, one could interpret from that graph that the actual temperature between the years 1880 and 2020 was around 14°C.

5 0
3 years ago
A small amount of chemical splashes in Frank’s eye. What should Frank do immediately?
viva [34]
D is the best answer

(I am just using my common sense)
Hope I helped :)
9 0
3 years ago
Other questions:
  • Rna processing involves the addition of ________ to the ends of the rna transcript. rna processing involves the addition of ____
    13·2 answers
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • During interphase, the DNA in the nucleus of the cell is thin and threadlike and called _____.
    14·1 answer
  • If the first low tide occurs at 5:10 a.m. on Friday when will the next low tide occur​
    5·1 answer
  • The number of hydrogen atoms in 6NH3 is ____.
    7·1 answer
  • 9. A recessive allele will only be expressed when _______________________ .
    13·1 answer
  • Brown hair is dominant over light colored hair. Cross two light haired people.
    11·1 answer
  • The rate of diffusion into a cell is based on the _______ of the cell
    14·1 answer
  • you are pushing a box to the right with a force of 15n. The friction from the floor opposes the movement with a force of 5n. Wha
    6·1 answer
  • What is pathogen????​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!