1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shalnov [3]
3 years ago
14

A device which makes work easier is called a simple machine

Biology
1 answer:
Norma-Jean [14]3 years ago
8 0

Answer:

In explanation.

Explanation:

What is the definition of that device which makes work easier that is called a simple machine?

-A simple machine is any device that makes work easier by changing force. Machines that consist of two or more simple machines are called compound machines.

How? There are many ways simple machines make work easier:

-The wheel and axle is a machine in which the wheel is attached to a central axle.

1. Machine makes work easier by changing the amount of force you need to exert.

2. The distance over which the force is exerted.

3. The direction in which you exert your force by increasing the distance through which force is applied.

4. Changing the direction of applied force, by multiplying the force of speed of the energy applied.

-Hope this helps.

You might be interested in
Why is my face round​
Virty [35]

Answer:

Symptoms and Causes of Moon Facies

Moon facies may cause the face to gradually become round, full, or puffy. The sides of your face may become so round from the buildup of fat that the ears can't be seen from the front of your face. Fat deposits in the sides of the skull can also make the face look rounder.

8 0
3 years ago
If carbon dioxide is removed from a plant’s environment, what would you expect to happen to its production of glucose
evablogger [386]
Answer: To decrease
8 0
3 years ago
Read 2 more answers
More force is required to accelerate an object with a greater mass than a
Brilliant_brown [7]
I believe it should be true, please correct me if im wrong
5 0
3 years ago
Sedimentary rocks form _____
Tamiku [17]
The answer is A.) Layers 
  hope it helps.
5 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • A diagram that shows thermal energy being released by objects is called a ___________.
    5·2 answers
  • One steep slopes and mountains helps reduce erosion by creating level areas for crops
    7·2 answers
  • Women with a higher body weight are more susceptible to bone fractures than those with a lean or lower body weight. question 18
    8·1 answer
  • Describe the electric charges of the three main subatomic particles
    6·1 answer
  • Read the passage below about acupuncture. Acupuncture is an alternative medicine that uses wire-thin needles inserted by a train
    5·2 answers
  • How does sugar affect people?
    6·2 answers
  • What organ produces estrogen and progesterone
    5·1 answer
  • Which cranial nerve is responsible for the motor innervation of pharyngeal muscles and parotid salivary glands?
    12·2 answers
  • What is the current model of our solar system
    10·2 answers
  • arrange the types of microorganism in the order they evolved on earth. view available hint(s)for part a arrange the types of mic
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!