Answer:
lysosome
Explanation:
It deals with food, and like a vacuum, stores things
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
D geothermal
Geothermal energy is harnessed beneath the Earth's surface.
Answer:
This question is incomplete as it lacks options, however, it will be answered BROADLY so the it can be understood enough to select the correct answer.
Please find the explanation below
Explanation:
Cells perform different functions and look differently because of the process of CELL DIFFERENTIATION. All cells arise from a single stem cell, which then gradually differentiates into different types of cells with different functions, as they divide.
At the molecular level, these different types of cells contain the same DNA sequence as rightly stated in the question. However, they look and perform differently because some of the genes are turned on while the others are turned off via the process of GENE EXPRESSION.
Therefore, a blood cell and skin cell possess exactly the same DNA sequence but look different and perform different functions because of CELL DIFFERENTIATION in which some genes on the DNA sequence are expressed and others are repressed. For example, in the blood cell; the genes coding for certain proteins found in blood are expressed while every other gene is silenced or inhibited. This allows those cells to perform only blood-related functions.
Answer:
The distance between them is changing at the speed of 10.16 m/hr
Explanation:
Consider the sketch attached below.
The question is simply asking to calculate the resultant of the two velocities.
To get the angle between them, we simply use the coordinates of the two vectors to determine the angle between them.
90 + 45 = 135°
from the cosine rule we have
= 
+ 
- 2abcosθ
= 
+
- 2 ×6×5×cos 135
= 103.426
c = 
c = 10.17 m/hr
