1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Musya8 [376]
3 years ago
12

GUYS PLZ HELP INinformation about world habitat day will mark as brainlist

Biology
1 answer:
klasskru [66]3 years ago
3 0

  • World Habitat Day is marked on the first Monday of October each year, and is recognized by the United Nations to reflect on the state of towns and cities, and on the basic right of all to adequate shelter.

You might be interested in
What is the function of the ring or annulus?
xxMikexx [17]
An annulus is the ring-like structure found on the stipe of some species or mushrooms. This represents the remaining part of the partial veil, after it has been ruptured to expose the gills or other pore producing surface. As its function is to disperse the spores. 
8 0
3 years ago
Read 2 more answers
Equilibrium is attained when ____.
GenaCL600 [577]

Answer:

a

Explanation:

8 0
3 years ago
Read 2 more answers
how do decaying organisms affect the health of an ecosystem? How would the complete removal of decomposers affect an ecosystem
Simora [160]
If you were to remove the decomposers all of the dead plants and animals on the ground floor would remain there and cause a build up of dead animals and plant matter not being removed via the decomposers
8 0
4 years ago
Why is anaerobic respiration useful?​
nexus9112 [7]

Answer:

It is useful during exercise. When the body doesn't get enough oxygen during exercise, it relies on anaerobic respiration for an energy supply. Instead of carbon dioxide and water, however, anaerobic respiration produces lactic acid. Also, anaerobic respiration releases less energy than aerobic respiration but it does this more quickly.

Hope this helped.

- profparis

6 0
3 years ago
Read 2 more answers
How is agas different from a solid
Helga [31]
The atoms and molecules in gases<span> are much more spread out than in </span>solids<span> or liquids. They vibrate and move freely at high speeds. A </span>gas<span> will fill any container, but if the container is not sealed, the </span>gas<span> will escape. </span>Gas<span> can be compressed much more easily than a liquid or </span><span>solid</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • Why is blood obtained through veins and not from arteries when collecting blood?
    15·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • One traditional flood control method has been to attempt to keep the streams flow within it's channel by creating_____?
    13·2 answers
  • Levels of organization small to large: cell , organelle, organism, atom, organ system, tissue, molecule, and organ
    11·1 answer
  • Greyhounds, a dog breed, were produced by humans breeding the fastest males and fastest females from each generation. What is th
    11·1 answer
  • In a species of plant, the allele for tall stem is
    5·1 answer
  • The first P-wave of an earthquake took 11 minutes to travel to a seismic station from the epicenter of the earthquake. What is t
    14·1 answer
  • List ten sources of water polution (LIST FORM, NOT LIKE AN ESSAY PLEASE!)
    11·1 answer
  • – Explain what happens to the incoming solar radiation after it is reflected off the surface of the earth (include what happens
    7·1 answer
  • Which of the following is a base used in DNA replication that is NOT used in translation?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!