1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zzz [600]
3 years ago
11

Why do birds have thick chest muscles​

Biology
2 answers:
sammy [17]3 years ago
8 0

Answer:

These muscles promote good control of the downstroke and upstroke movements of the wings for flight. It allows them to make powerful strokes and this leads to smoother gliding during flight.

faltersainse [42]3 years ago
7 0
They said it better than I would’ve but it’s right
You might be interested in
Trees in the rainforest store __________, which is released into the atmosphere when the trees are cut down and which may contri
snow_tiger [21]
Trees in the rainforests store CARBON DIOXIDE. The trees absorb CO2 and therefore when they are cut down, they release the stored CO2 into the atmosphere which contributes the climate change. The correct answer to this question is letter "B. Carbon Dioxide". I hope this helps.
3 0
3 years ago
Read 2 more answers
Cellular respiration takes place primarily in organelles called mitochondria. Some textbooks claim that "Mitochondria make the e
tigry1 [53]
Actually, the mitochondria does not MAKE the energy, it just makes it usable to the cell! It is through cellular respiration that this can take place. 

Thank you for the opportunity to respond to you, and I hope this helped. I wasn't exactly sure what you were asking... if you would like more help, I would be more than happy to assist you!!! 
8 0
3 years ago
What is photosynthesis
geniusboy [140]

Answer:

Photosynthesis, the process by which green plants and certain other organisms transform light energy into chemical energy. During photosynthesis in green plants, light energy is captured and used to convert water, carbon dioxide, and minerals into oxygen and energy-rich organic compounds.    

8 0
3 years ago
PLEASE HELP ASAP WILL MARK BRAINLEST!!!!!!If both your mother and father have PKU disease, what is true? A. You will not have th
Tresset [83]
Since PKU is a recessive disease, each parent's genes can be represented by pp. When you complete the Punnett square the results in each square are pp. So, since all of the square have pp, there's a 100% chance. 
8 0
4 years ago
Join my Kahoo t<br> pin-04454287<br><br> join if u like anime
kipiarov [429]

Answer:

sure

Explanation:

are we a big weeb or are u normal

4 0
3 years ago
Read 2 more answers
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Keisha was reporting to her class about the benefits of caffeine. She stated that it heightened alertness. She also showed graph
    12·2 answers
  • A yellow fever mosquito has 3 chromosomes in its eggs. how many chromosomes does it have in its wing cells
    14·1 answer
  • Biologist have classified broader groups of life form into super kingdoms that are known as what?
    8·2 answers
  • In the early 1900s Germany geologist alfred wegener began to question how the structure of Earth formed over time he proposed th
    13·1 answer
  • How do polar molecules differ from non polar molecules
    7·1 answer
  • Honey bees feed on pollen for protein and nectar for carbohydrates.
    7·1 answer
  • A group of students is asked to make a model of a plant cell. The group is given different objects to represent cell parts. Thes
    15·1 answer
  • What is chlorophyll ? ​
    15·1 answer
  • A man who is a dwarf with achondroplasia and normal vision marries a color-blind woman of normal height. The man's father was si
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!