<h3><u>Answer;</u></h3>
Rock
<h3><u>Explanation</u>;</h3>
- Rock is a naturally occurring solid mixture of one or more minerals or organic matter.
- <em><u>Rock is a solid mixture of crystals of one or more minerals, or organic matter.
</u></em>
- <em><u>Rocks are classified by how they are formed, their composition, and texture. </u></em>Rock has been an important natural resource as long as humans have existed.
- The rock cycle is the series of processes in which a rock type changes from one type to another.
<span>If the liver cells of an animal have twenty-four chromosomes, the same animal would have twelve chromosomes in its sperm cells. Chromosomes are paired into two types, the X and Y components. The Y components are the sperm cells of an animal.</span>
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
It is possible! I can't do a Punnett square, however, but if both parents are carriers (Ww and Ww), then a child has the potential to inherit the recessive gene from both. <span />
Meiosis results in 4 haploid cells from 1 diploid, therefore the statement is false.
