1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naya [18.7K]
3 years ago
7

Igyydcc vdvvggggghyhhhhjjjjj

Geography
1 answer:
Mariulka [41]3 years ago
4 0

Thanks for your support Please mark me brainliest thanks

You might be interested in
Through which three nations do the Tigris and Euphrates river flow
Kruka [31]

Answer:

the tigris and Euphrates river flow through Syria and Iraq into the Persian Gulf.

8 0
3 years ago
Earth's axis of rotation is almost parallel to the plane of its orbit. true or false
irakobra [83]
I believe it is false 
3 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
What factors are considered when determining a country’s rate of natural increase
Vlada [557]

Answer: Crude Birth Rate and Crude Death Rate

Explanation: Both indicate the Natural Increase Rate of a country

4 0
3 years ago
What is one disadvantage of using wind energy rather than burning coal to produce electricity
vredina [299]
Personally I would say it's A (apart from the installation costs which may make it a little expensive) but it does involve certain aspects of D also as wind energy doesn't cause pollution. So either A or D! 

Hope I was of help! :)
3 0
3 years ago
Read 2 more answers
Other questions:
  • The image shows a volcano erupting at night in Russia.
    11·2 answers
  • ________ make up the suspended loads of most rivers and streams
    12·1 answer
  • Simply explain access to education in England.
    13·1 answer
  • Question Completion Status: Which of the following should you expect to do when you do workplace research? O Take plenty of time
    5·1 answer
  • The lines marked by the letters A, B, and C on the map above represent __________. A. chains of volcanoes B. earthquake fault li
    6·2 answers
  • How did the arabic language become the most common language of the region?
    12·1 answer
  • 2. Which of the following describes a virus?
    7·1 answer
  • Mance Matters
    15·1 answer
  • 2.000<br>1,500<br>Number of individuals<br>1,000<br>1930<br>Year<br>describe population change over​
    8·1 answer
  • How do climate and vegetation affect life on Earth?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!