1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maw [93]
3 years ago
7

How can failing to conserve water contribute to greater water contamination?

Biology
2 answers:
salantis [7]3 years ago
7 0

Answer: It's D

Explanation: Edge 2021

hammer [34]3 years ago
4 0

Answer:

d) all of the above

Explanation:

You might be interested in
You are a reporter working in 2001 who's just been assigned a story on how ciprofloxacin may save the lives of Senate staff expo
Charra [1.4K]

Answer:

Bacterial DNA is a double-stranded helix that has to separate its strands during replication. The unwinding of DNA strands at the replication fork creates twists farther down the helix that need to be relaxed by DNA gyrase. Ciprofloxacin inhibits this enzyme to block DNA synthesis and stop the deadly bacteria from growing.

Explanation:

DNA which stands for deoxyribonucleic acid is the molecules that stores genetic information in most living organisms. For successive reproduction to take place as well as growth to occurs in organisms, the genetic information stored in the DNA must be copied into new cells. This is achieved through the process of DNA replication.

DNA is a double-stranded molecule that is helical in shape. For replication to occur, the double strands has to be separated so that the information stored within can be accessed and then copied. DNA helicases are enzymes which are essential during DNA replication because they separate double-stranded DNA into single strands allowing each strand to be copied. The unwinding of DNA strands at the replication fork creates twists farther down the helix that need to be relaxed otherwise, the DNA strands will break. The enzyme responsible for relaxation these twists is known as DNA gyrase. Thus, any drug like Ciprofloxacin than inhibits DNA gyrase will block the DNA replication process in bacteria thereby stopping the growth of the bacteria.

4 0
3 years ago
Which class of organisms gather their energy directly from the sun? a. autotrophs b. carnivores c. herbivores d. detritivores
Rasek [7]
I believe it is A.Autotrophs because carnivores gather their energy from eating meat and herbivores gather their energy from plants 
5 0
4 years ago
Read 2 more answers
If you multiply an objects weight times its height what value do you compute?
Verdich [7]
It's the pull of gravity on an object.
Hope this helps!
7 0
3 years ago
Read 2 more answers
Where does carbon come from? what is made of carbon?
lina2011 [118]

Answer:

Carbon is also found in the atmosphere where it's a part of carbon dioxide gas emitted when fossil fuels are burned and when living organisms breathe. It's in organic matter in the soil, and it's in rocks. But far and away the most carbon on Earth is stored in a surprising place: the ocean.

Explanation:

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • GTP or ATP is produced during the conversion of ________.
    7·1 answer
  • Explain why cheek cells appear less complex than a paramecium
    7·1 answer
  • Sample Response: When there is less rainfall, land,
    15·1 answer
  • Volcanic activity was more frequent in earths past then it is today <br><br> True or false
    15·1 answer
  • The ability of an organism to produce light is called __________
    7·2 answers
  • Which of the following best describes the shape of a DNA molecule?
    12·1 answer
  • using your knowledge of protein structure explain in detail the effect of exposing an enzyme to a pH outside of its optimal rang
    11·1 answer
  • As a follow-up experiment, researchers placed Daphnia that were exposed to the Notonecta chemical cues into a tank without chemi
    7·1 answer
  • A kitten has mostly gray fur, but patches of white fur form around its eyes, ears, and belly. The two parents of the kitten do n
    11·1 answer
  • True or False: Protists can be<br> heterotrophs (consumers) or autotrophs<br> (producers).
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!