1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariulka [41]
3 years ago
11

How many centimeters are in 3.5 meters?

Biology
2 answers:
S_A_V [24]3 years ago
4 0

Answer:

350 just use the king Henry died drinking chocolate milk method

Explanation:

3.5 x 100=350

Xelga [282]3 years ago
3 0
3.5 meters = 350 centimeters
Formula: multiply the value in meters by the conversion factor '100'.
So, 3.5 meters = 3.5 × 100 = 350 centimeters.
You might be interested in
What is it called when vesicles are used to move substances into a cell
tatuchka [14]

Answer:

Endocytosis

Explanation:

Some molecules that are required by a cell are so large that they cannot pass into a cell by either the cell membrane or by any carrier protein. These molecules are transported into the cell by the process named as endocytosis.

In this process, the cell membrane forms a vesicle, a membrane-bound sac, around the large molecule. Then, the vesicle pinches the molecule into the cytoplasm of the cell. Energy is required for this process to occur.

6 0
4 years ago
Read 2 more answers
Falling action for the movie coco
m_a_m_a [10]

The falling action in the Coco movie is when Imelda and Hector decided to patch things up and forget about what happened in the past. After that, they work together to expose Ernesto of his crimes and eventually dies.

6 0
4 years ago
Read 2 more answers
Nitrogen is required for growth it is considered an essintisl
Margaret [11]
The answer is nutrient
4 0
3 years ago
.......... is generally not the same on any two consecutive days.​
andre [41]

Answer:

the answer is c

Explanation:

4 0
3 years ago
Which parts of the monomers involved in the dimer formation​
vazorg [7]

Answer:

A dimer (/ˈdaɪmər/) (di-, "two" + -mer, "parts") is an oligomer consisting of two monomers joined by bonds that can be either strong or weak, covalent or intermolecular. The term homodimer is used when the two molecules are identical (e.g. A–A) and heterodimer when they are not (e.g. A–B).

Explanation:

8 0
3 years ago
Other questions:
  • Periods of growth for the economy followed by downturns describes _____. real GDP final goods and services economic cycle
    11·2 answers
  • How many mitochondria would<br> you expect to find inside a typical<br> eukaryotic cell?
    11·2 answers
  • Which is the best definition for directional selection
    14·2 answers
  • An equal number of protons and neutrons in an atom typically results in an atom that is
    11·2 answers
  • Which graph BEST shows the relationship of kinetic energy (solid line) to potential energy (dotted line) as a hawk dives downwar
    8·2 answers
  • The hypothalamus sends messages through both the nervous system and the endocrine system.
    7·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • You want to test Charles Darwin's prediction that an orchid with long pollen tubes has a pollinator with long, thin mouthparts t
    8·1 answer
  • In airports, the control tower functions in directing air traffic and keeping all flights running smoothly like a command center
    12·2 answers
  • What does the aliens were nitrogen based life forms mean
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!