1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shtirlitz [24]
2 years ago
11

Use the following picture to answer question below

Biology
1 answer:
algol [13]2 years ago
7 0
Answer is A.. hope this helps:)
You might be interested in
During which step of mitosis does a new membrane form around each of the two groups of chromosomes? **just the answer please**
dmitriy555 [2]
The answer is telophase
8 0
2 years ago
among the typical midlife changes for men are a(n) . a. loss of body fat b. increase in testosterone production c. increase in p
Tcecarenko [31]

Among the typical midlife changes for men is an Increase in prostate size.

A portion of the fluid that carries sperm during ejaculation is produced by the prostate, a gland. The urethra, which is the tube through which urine leaves the body, is surrounded by the prostate gland.

As you get older, your chances of having an enlarged prostate go up. Because BPH is so common, it has been said that if a man lives long enough, he will all have an enlarged prostate. Many men over 40 have a small amount of prostate enlargement. The condition affects more than 90% of men over the age of 80.

Know more about prostrate here: brainly.com/question/29494316

#SPJ4

4 0
1 year ago
(WORTH 30 POINTS!!!) Choose the answer that best describes the geologic process that contributes to the formation of fault-block
lukranit [14]

B) The Earth's crust is pulled apart creating deep folds and then pushed together generating steep scarps to create fault-block mountains

7 0
2 years ago
Frank performs a contract with gene to add a garage to gene’s property, but gene does not pay. frank can file a lien on gene’s p
Shtirlitz [24]

With the given scenario above, Frank can file a lien on the property of Gene from the beginning last date labor or the materials that were provided, he can act within the days of sixty up until one hundred twenty days.

6 0
3 years ago
Quais são as principais propriedades de uma onda? Descreva cada uma delas explicando com suas palavras de que forma cada proprie
Andru [333]

Answer:

can you translate this is English?

5 0
2 years ago
Other questions:
  • Will there be water flow into or out of the fish without proper homeostatic processes? Will the fish experience "bloating" or "d
    14·1 answer
  • List three conditions under which a reptile might redirect blood away from its lungs
    6·1 answer
  • Which two elements share similar properties?
    6·1 answer
  • Improperly digested nutrients may indicate a problem of which tissue layer
    10·1 answer
  • How to use active transport in a sentence?
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which is the largest group of organisms that can interbreed?
    8·2 answers
  • Hello help plz :):):):)(:(:;??:
    6·1 answer
  • HELP!!! please and thank you
    13·1 answer
  • How do genes code for specific proteins and traits gizmo answer key
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!