Answer:
The answer is G
Explanation:
This is because cells cannot just appear out of thin air all cells have to have come from pre-existing cells.
Heterotrophs, tertiary consumers and top carnivores.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Breast milk provides antibodies to fight diseases.
Breast milk is produced by mammary glands in the breasts and its main function is feeding an infant. Breast milk is the primary source of nutrition for newborns. The composition of the milk includes immune-boosting white blood cells, as well as stem cells, which can help organs develop, antibodies, proteins, amino-acids, oligosaccharides, growth factors, hormones, enzymes, vitamins, minerals…
