1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
3 years ago
14

William would like this bar magnet to move back and forth from left to right using attraction. What objects does he need to plac

e at each end to make it move
Mathematics
1 answer:
dlinn [17]3 years ago
5 0

Answer:

to of the same end magnots

Step-by-step explanation:

You might be interested in
450 yards in 15 minutes?
madam [21]

Answer:

30 yards per minute.

Step-by-step explanation:

Unit rate is basically when the denominator is 1. In this case, 450 is divisible by 15, so if you divide that, you get 30.

4 0
3 years ago
Read 2 more answers
Write863.141 In expanded form
skad [1K]

Answer:

800+60+3+0.1+0.04+0.001

6 0
4 years ago
Kristen and brett found three different deals on the same smart tv they want to figure out which deal is better before tax
Makovka662 [10]

Answer:

Option 2 would be the better deal, as long as they would only pay $ 87.37 for the smart TV.

Step-by-step explanation:

To determine which deal is better before taxes, the aforementioned discounts must be made at the original prices and their results compared, through the following calculations:

1)

320 - (320 x 15/100) = X

320 - 48 = X

272 = X

2)

349.49 - (349.49 x 75/100) = X

349.49 - 262.11 = X

87.37 = X

3)

280 = X

 

Therefore, as can be seen, option 2 would be the better deal, as long as they would only pay $ 87.37 for the smart TV.

5 0
3 years ago
Fill in the blank<br>-2×-12=​
maks197457 [2]

Answer:

24

Step-by-step explanation:

A negative times another negative results in a positive number

2 times 12=24

-2 times -12=24

8 0
3 years ago
Read 2 more answers
How do you find the length in feet of a circle
Alika [10]

there is no length in a circle

4 0
4 years ago
Other questions:
  • A company employs 48 people in various departments. The average annual salary of each employee is $25,000 with a maximum varianc
    8·1 answer
  • Debra is on the swim team. Each day she swims 850m. How many kilometers does she swim each day?
    9·2 answers
  • A restaurant offers 2 kinds of bread, 3 kinds of meat, and 4 kinds of cheese. How many leaves on a tree diagram would represent
    10·2 answers
  • The sum of two numbers is 128. Their difference is 114. Find the numbers
    9·1 answer
  • Answer for all please
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • An item is regularly priced at $35. It is now priced at a discount of 65% off the regular price. ​
    15·1 answer
  • The unit rate of video games is ?<br><br><br><br>How much would you pay for 10 video games?
    14·1 answer
  • Please help asap im confused
    15·1 answer
  • If Matthew decided to put his $10,000 underneath the mattress, what is his future value of that money worth after forty years la
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!